Description :
Non Conding Region
Location :
Scaffold_1:135404- 135525
Sequence
121 bases(100 bases per row)
CCGAGCCTCGACCCAGTGTTGTAAGCTTAGGCATAAGGCAAGAAGACATCGACTCCACCAGTGCAAGTAAGGAGTATTAAAACTAACTAATTTGATTAGA
TATCCCATAGAAGTTCAAGAT