Description :
Non Conding Region
Location :
Scaffold_1:135287- 139805
Sequence
4518 bases(100 bases per row)
CTTAGAGACAACTAATCAAGCCTTGGCCAGCGCCTTGTCCTCGCTATGGTCCCAGTTTGGCCCGCGCAGCGTAGCCTTCCCGCCGTTTTTTGCAGGCGGC
ATCCTGTTCTTCGCCAGTTGATCCTCTGTGTCAATTGAGTTCTTATAGCGGTGCGCACTGTCCGGTAGAACATAGAGCATAACTGAGCCAATTACATGAA
AAGGTCGCAGTAATTCTCGGACACGACGATTTGCTTCTGACAGCAAACGCGGAAGCAAATTGAGCTGATTTGCTGTCGAACCGGGAATTTATTTGCTGAT
ATCTTAGTTTGGTGCGTGCGGTGGGAGTGGTCGTTCGGTAATTTATCGCAATTTGCTGTTTTATCAGCAAATTAGGGGCCGCGGTGGAGATGTCCTTAAT
AACTTATTCAGCGATTGGTATCGATCTTTAGTATAAATCTATTTGGTGTGCAATCGAGGGTAACCATTTTTAAATAGGAGCCCACTTAAAAAAATAAGAC
TATACAAGTCTAAATAAGACTCTTAAACGACTGATTTAGAGTCGGATTAGACATTCCGACCAGTTTTCACAATATAATAAATATCTATACAAAATACACT
CAAGCAAGCGCTGACCGAGCATCAATACGGCCTCCATACCGCTCAACTCGTTCTTCTCGTCTGTCATATATTATTTGAGCTATATGGCGTGGTTGGCCTT
GATGTATTGGAGCATGGGAGTAGTGGGCAGCACCTAGAATGTAATATATATCAATAAACGATAATGATAAAACACTGAAACTGCTGCTCGTCACGGCGAG
CGTCTTTCATGTAGGTCAGCACCATCTGGAGAACGGGATTGATTCCCGCCGCCCTTGACCCTTTAGTACTTCGTGCAGAACCGTTGAAGCCATGATCGTC
TTGTTCAGTCCCAGTCTTGTAGCGTCCGTTGCCAGCTGGATTGACGCCAATTTTTTCTGCCAAAGCGATAGCCTCCCGCTTTTTGGCTGATAGTATATAA
TGTTGCTTCGAAAACCCCTTGTTGAATAAAACTGCCAGCGCGAGCTGCCTGGTCGAGCTGACTACGAAAGCTAACAATTTTTATTGCATTGGATTAGATA
AATTATTTCCGTTATTTTTTTCTCGCACCGATAACCCCTTTTCTAGTTGATGTGTTTTGCTGGGTGAGTGAGTGGGTGGGTGGGGGGGGGGGAGGGGGGG
GGGGGTACGTCGCTGTCTGTATCGTCGATCTATTCGTCTCACCCTCCACTAAATGGCAATCTAGTTTACACATTACGCTACAATCGCACAAAAAATGACA
ACATCATTTGCTAGCCTTGCTTAATGATTTTACAACGTTATAGATAAAGCGAATTTCCCCCACGTAATCTAGGAAGTCAACCCGCCGTCGTAAATACATG
ATATTGTACGCCGTGTTTGACATGATCCTTAAATTTAGCACCCACGCGGATAGCGAGAATCCGATCACCGGCTAGCCCATCAAGTTTGTCTAGGGCGAAC
GCTCTTAACCGCATATTGACCTCATTTGCAACCAGTTTGTACCCGTTTTCTTTACTCGAAGTCGTCCTAGATGCACCAGATACACTGCTTTGATCAACAT
TTTGAGAGATCTTGAAGCGACTACCAGTACTCGTTAGTCGAGGAGTCGATTCGGACCGATTTCTACAAATCCACCGGCGGGGAGAACAAAACACACCAAT
TCAGGGTATTGGACAGTGCTACGCGCACAGCGTGAACTGTCTCGATCACTTTCAACGCAAGAGCCTTTTCACGCGGAATCACTCCTTCACCTTAACACGA
TGAATCTCTTAGCAACAATATCTACGAATAGCTCAAAATTTGTGTGGAGTGGAGCAGTGTCATAAGGAAAATTTCAAGTTTGCTGGAAACGTGTCCTTAA
ACTTATATTGTGTGACGGGCTTTCGCCACACAGTCGCCATCGTGCTCGCACGATGGCCAATTAACACTCAGCATAGGTTTAAGTGGGCACGGCGTTTGTA
CCGTGCCAATCAATCAAACAAAGTTCAACTCGTCTACTATATCCCTCTGCTGGTGTAAGCACGTAACGACCTGCAGTCAGCCCGTTACATCTGGTAACAC
TTCGCTAATCCGTCCAACGCCCAAGATCGTGGTGAACATGAACGACTCGTCGATGCCCGACGCGTTCCGGACGACCGCCACTTCACTCAAGCGCGCCAGC
TTTCCGCACCTGTCGGCGATCGAGTGGGAAGCGCTACACCGCCTCGCAGCGGTGTCCGGCGATGCATTGATCAAGACACTGTTGACGGCGGGATCCGAGG
AGCAACAATGCCTGGTCGCCCAGGAGTTCACAGCGCCTGAACTCGCTGACCTCCGTCAGCGAGTGCACCGCTGCTACTGGTGATCCGTCTGATCTCGCTG
CGCCTACGCTCCTGTTGCTGTTTGATCTTGGTACTGCTGCTGTCGCACAGCAGCGCGACGACGTCGGTGCTCCTCCTCCAAGCCATCCCGACGATAACGC
TGCACGGTTTCAGCGTGACGGCCCTGCGCCGCTTGTAGATAGCGCTGGTCACGTTCGCCATATCGTGAAGGCGACCCTGAACACGACGATCATTGCGCTG
CCCCACGTGCTGATCTTCCGCATCGCGGCGTCCGCGGCTGCGATCCTCACGTTCCCAGGCACCATCCGCTGCGATCCTCACGTTGCCATGCACCGTCAGT
ACCTTGTGCGTTGGCTGGGGCCAATGCCGATAGTTGGGAGCCTCGAGGTCCTGATCAAAGACGTACCGGATTGCGTGGCGGCGTACGAGGCATCTCTTGG
AGGGGCGGCGAGGCTTCGACGTGGCGCGGCCGTCTGCCGCGCATAGCGATATCAACAGCTTCACGATATCAGGTCCGTCAAAGGAGTTGCAGCAAGGAGA
CGCTTCCACGCAGCTTCGTCCGGTCGCGGGAGATTGTACCCGCGACAGTGTGCACAGGTGGACGTAGTCGCAGTTGCGGTCGGTGCCATACGGCGCATCG
TGAAGTTGCTTCGCCAGCGCGCACACAGAGCGCGCTCATTGCTCTCCCTCACGACGCTCCAGTCATCGGATAAACATAGCGGGTACTTCGACATTCCATC
GGCGCACGAACGGCGTCCACGCAGCATCCAACGACTACATGGTCACAGTGCGCAGCACCGTGTCAGACTTACTGCGAGCTACGCTATTTCAGTGGAACAA
ACTCTGCATCTTCTCATTGCCCAGCGGCGCTCGCAGACCGCTGCAGTCGTAGAGCGCCCATCGTCCCATGTCCTCACTGTTCGTCGTCGTTTCGGCCGCC
TCCGCCGGCGCGGTACGTTCCCCGCGCTCGTGTTCTGGTGTTCGTCGTCCGCCATCGTCGATGTCCGTCTCCAGCTTTTCTCCTGCTTCTCCGTTTCCAA
TGACCAAGCCCGCAATCACTAAGCACGTGCACTTAGCCCGTTACATATTGGAGCTAAAGTTACTACCCAATCTTACAAACGCATTGCCTAGTGCCGCGCG
ACTCCGATGTTGCAGTAGACAAGAAGCACGGTACATTCGCCACGAAGACGTAGTATCTGGTGTTAGTTCATTCAAGATTTAGCATGACGGTCAACATCAA
TGTTTCACTTGAAATCTGCATAAACCTTTTGTCAGAACAACATGCTTTACCGCCTCGATCTCGATGATCTATTCGTGGACGCAGCAGTTGCCATCACCAC
GACAACGGGTCATCTAGCCAAAGCGATGTAATCTCTTTGATAGACATGAAGTGAAAAAATGCTTATAAATGGATTATCTACGTATAACAATAATGTATAT
CGAGTTTATGCCTGATATATATCGGGGAATAACTAATAGTATCTTGCGTTGGCCAGCAGAACTCAACAGCTAATGTGCAAGCGCTTTGTGCTCCAGATGC
TTCCCTGGCGAAACGTAGGCCTGCTTGAAGTGGATTTGCCGTCGAGGACGTTCCTCGTGCATAGTTGTTTTATCTTTGCAAAATATCTAGCAGCACATAA
ATTGTTTATTCATTTAATTTTGTGATGCAAGCAACTTGGTCACCTGGTAAGATTGGTTAGGTTAGAACATCTCGCTAAGAATTTGTAGCGCTTGTAGCTT
TACCTCGGCGATGTCTCCAAACCAGCGGAAACACCACTCGCAGAAGCGTTTGCAAATACTTTTTAAAACTGGATAAACTGTTGAATTTTGTCAAAATATG
GTTTGACGACGATGCCCACTCGACAGTGCATCGACTTGATGCACACAAAACATTAACCATAGCTAAATCAAAAACGACTAAAATTAAGTGCCGTCGAAGT
CGGTGCCTGTAGTAAAAGTACATAATCTGGTGAGATTTGTCAGATTTCGGATCGGTGGTGTTGCGGAGAGGGTCTTGAACTTGGGAGAAGAAGGCGACTT
AAGTCTAAAGAATATAGAATGAGTTGTGATTGATTGCGTTAACTGTCAGTTCTGGTGCTGGTTTCTCCTTAGATCCATTCATGTTAACCCTATCAAAACT
TTAAGACAGGTTTGCGTT