Description :
Non Conding Region
Location :
Scaffold_1:135269- 137892
Sequence
2623 bases(100 bases per row)
ACGCCTCTCAGCACCAGCGGCAGCGCCAGCAGCCAGCACAAGCACCAGCAGCAGCCTCAGAACAGTCGACCGCTTCGATTCGGTTCGGCTGCACATCTCG
CCCGCACGTCAGATCTGAGGCGGAGGTTCAGATCTGAGGCGTCCCGCTCAGATCCGTTCAGCTACAGGCGACTTCAACTCGGGTGCGCAACACGTGGGCG
ACCGCGTATTCGTGTCAGAGGAGACGAGCGGCCGCCAGCGAGTAGCCGAGAGGCGGACTATCGTATTGTGCAACGCCGCCAGTGAGGTACCTGCCGTTGG
AGTTGCACGCCCACAGCGTTACTACTAGCGGATCTTGTGTGGTGGGAGGCCGCCAAGCTCCATGCGCGTAATCCGGGCCGCCTCATTTCGGGAGCTGGAA
AAAAAAAAATAACCTGGCGCTTACGTGTGCAAATTTAGCACTGAATGCCAGCTGACTGGCGACCTTCCTGCACCAGGCACTCAACGTTCCGGGCCAGGTG
TTCGGCGTACCTTTCGCGACGCGGGCCAAGCCACGACGGCTCTCGTTGGTGTGAGTACAGTGAGCCTCTTCGTCATCCGGCGAGCAAGTCTCCGCGCGTG
AGCGACGCTTATTAGCACTTTTCCGAGCTGACAAGGCTATCAAGCTGAGCGCAACCGCGTTCACTTACACGGACGGTCGATGGTCCAGCGCGTGAGCCTG
AAGCGAGCGCTGCCGGTTGCTGTCGCGTCCATCTCCGTATGCGCTGGAGTCCCCCACGAGCGAGCCCAGGCGGACGCACAGGTGCTTCAAGGATACGCGG
GTACCTACCACTTCAACCCTTCGCTCTCCTGCAGTTCAAGCATTCCAGCGCTTCGACACGTCCAGCATGACGCAGCAGTTCCCGGCGTTGCCTGCTTGAG
CGCTGCGGAGTGGACGTCCGCGAGCTGCGGGCGGTGCGTCGAAGCGTGGTGCAACGACAGTGTCGAGGAGTGCAGCCACACGGAGCCGCAGGTGGTGCAC
ATTGTGCAGCAGTGTGCAGATGATGTCGATGGTCCGATCAGCCTGGGAGTTGCTCCAAGCGTCATCGACCGGATCAGCGGCCACAAGCACTCGAGAGCTT
CAATTCGATGGCGCTATGCGGCTTGCCCGCACGAGACGACTGAACAGGGACACCGAGCGCTGCGCAGCGCCGTGTCTAGCGCGGCCGAGTCTCCATCAGC
ATCCGACGCCAACAATGGAAGCATCGGCGTCGCGGTAGAAGACGACGGGAGTGGGAGTCGACCGATAGAGTCTGTCGACTGGCCAAACGCCACGTCAAAC
GCTACCAGCCAAGGGTGGAGTAGCAGTGGGAGTGGCAGTCGCCTACCACCTCACAGCAGCTCGGCTAGCGGTTCGGCAGCACAACGCATTCCAAGCGCGA
CTTTCCCAGCACCAGCCTCCGAGCAACCATCAAGCGGCACAACAAGCGAACCCAGCATAGACACGACAGCAAGCTCCACGCCAGCGCCACCACCAGCAGC
TGAGACGAGCAACGGTGCAGGACTGACGATGAACTCGCCAAGCAGTGGTGCTCCAAGCTCAGCATCCACGTCAGGAAACCAGCCCTCAGCTAGTTCCAGT
GTATGGAGCTCATCGCCAGTTCCCGCAACCACAATCCCGACATCTACGGCCGCCACCTCGCCGGCCAATACCCCATCGTCAAGTGAATCCACGCCGTATT
CGAGCAACCCAAGTGGACAAGCCAGTCCAAGTGCCATCCCAACACTTGAACCGAGCACAATGCCATCCGAGTCACCCTCGGTCTCGAACCCGGTGTCCTC
GACCCCTGCACACTCACAAGCCTCCAGCGGTGTAGCAGGATCCACAATCTCGTCGACGCTTAGCCCGACCACGACCACGGCCACTCCATCACAGACCTAT
AGCCCTTCGCCGTCATCTGAAGAGCATTCCAGCCAAGCATCGACGACTCCCCGACCGAGCAATACTGCACAGTCCTCAACCCCATTGACCGCCGAACCCC
AGTCCCGATCGGATGCTTCTCCAAGCGGCCCGGACAACGCTACTTCTACGAGTAGACCCGACAGTCAGCAGCAGAAGAAGAGTGGAGGCACCGAAGGTTC
GAACGGCTCCGGCAGCGAGAGCGCCGAGTTCACGGACGCGAGCGGCTTCACCATGCTGCTCTTCCTGGGCTCCGTCGTGCTCGGGATCGCGGGCATCGTC
GGCGCCATCATCGTGTGCCGCGCGAAGCGCAAGCGCGACCACCACACCGAGTGGCAGCAGTACCAGTCCAGCTTCTCGTCTCCCGCCGCGCTCGCAGCTG
CGGCGAACGCTCCGCCGCGACCGTCGCCAACCGTGTTCGCGCGCCAGCAAGGCGAGGTCCTGGCCATTCTGTAGAGTAATTAAGCACCGCATGTACAGCG
GCAAATAGACCGCCGTTGGTCGCTGAGCTGTCTTCCTTGCATGAGGGAGGGAAGTTGCCGCCGCGCGAGTTGCTTTTCCTTGTTGGCGATTCCGCACTAT
CGGCGCATTCACGCTTCAACTCGCGAGTATACAAAACGCAAGATAAACTGCGAGCGTGATGCGAACCACCACTCCTTGCCCTTCTTCATTCACTCTGCAA
CCACATTCCCCATATCCGATCGA