Description :
Non Conding Region
Location :
Scaffold_1:135199- 135835
Sequence
636 bases(100 bases per row)
atttacaaacaacactccgccacttcattgtcctatggcactggtacttccgtcttcaaggcatcaggagcaatcgaactggaaatcctcccgacaacaa
gaggtatccatccttcgtattaacgatcgtgactttggctctgggatcagttgctggagtcattgtaatgatcgctcatagatgcattagcaatgagacc
tcagcctccaagcccaacccgaccatcctgactttaaagcgaaggataaacccaagcattggaccttttcgagaagatgcatttagcgagtcagacatga
gccttgccagcagcaggatcactacgtcttacgcttgataaacgtgtatgcaatagaagaggaacgctgtaaggagaaatgcttcgacagttgagcagct
aattctctgtcatgtcactgcgaggatggcttcaacttgatgtagccatgtgcattttaggagataaggtccacgtggccaatcacctcagaaatatcca
atttcacaatggttttcaaaatcgaagatattatgaaaaaaggaaacaccgtgtaaagaatcttcaagtatatgttataacagggtagcaagtgttaaag
gtaattcctcagtgattagttcagttttgaaaccgc