Description :
Non Conding Region
Location :
Scaffold_1:135182- 135271
Sequence
89 bases(100 bases per row)
GACACAGCACAAGAGATGACAAACGCATAGGCAGACACACACAGAACACATGTTGACGTACATAATGAACCGCAACGGCAATACGAGTT