Description :
Non Conding Region
Location :
Scaffold_1:135175- 135360
Sequence
185 bases(100 bases per row)
AGCGAGCAAAACTTCCTACCCCACTGCCGCAAAAGGTGACTGAGTACCGGTACATCTTTACCTAAATATCAAAACTTGCTTCTAACAACGTGTGCAGCGA
AAAACATGTAGCAAAATTGGGAAGGCGGTGCTTGTTCTCTGATGATATCGGTGACGAAGATCAGAGGGCACTTCTTCTGGTTATT