Description :
Non Conding Region
Location :
Scaffold_1:135172- 135996
Sequence
824 bases(100 bases per row)
GGGTTTCGACTAAACGGCTTCGACTAAACCCTTTGGCTTGTCCCAGCGTTGACGTTAAAAACACACACTCTCTGGGTCTGGCGCTCTTGGTCGTATTATG
CAAGACGCCCGCGTCTCGCAGAAGCGGCTTCTCGAACCACGTGGAGACATCGCGATGCTGCGTCGATACAAATACGTGGCGCTCCGCAGCGACAAGTCGA
TCGCCGCACGCAATGTATATATAGTCGTTCGCAATGTAGTTATTACTACTAAGTAGCTGGCTGCTGCCAGCGCCCAGTGGCCTTGAATTGGATAGCAAAT
CCATTCCTTTATGCGTGGATCCAACCAAGCACCATTCCGGAGATGATGTGCGTCAAGGAGATGATGGCAGCTGACCAAAGTGACTAAAGTTGAAGTCAGT
CGCACCCGTGTTTCTTGGTGCACACCTCCATCATCAACTTGTCGTGCTGAGATGCTTCGATGTCACTTCGCGACCAAGTTTGTAATGGGACCACCAAGTA
CGCTGGTGTGGGCAAGCCTCGCACTAGACCCGATCGAGGCAACAGCCCATGCGCCGTTGTGCTCATGCTTGGTCGGGCCGCGGACGTGGCGTTCGTGGCG
CTTCTGGGTTGCCTTTAGTCGGTCGTTTAGTCGATTTGTAATTGTGTTGAAACGGCGCCGTGGCGCATTTTAGCCAATCCGGGCGCGGTTGCGAACTTTA
TTGTAGTATCTCTTCTATTTTAATGATGTATTTGTATGTAATCGTCTTGGCTCGGTCAATAAATTACGTGGGCTTTTATTGTTGAGCCCGGAGATGGATC
CCGGAGGTTCCCACTCACATCTTC