Description :
Non Conding Region
Location :
scaffold_1:13515- 14270
Sequence
755 bases(100 bases per row)
TTTCTTACAACTCACTGCGCTCGATTCATTTTACCAGGGGAAAAGCGGATATCGACGATTACTTGAGGAACGCAAGCATCTCGCAGTATACATGCGTGAC
AAGCTGGAGGCCTTAGCGGCCGAGGAGGGCGAACGTTTGCTGCGGGTTTCCAGTAATGAGGTATTAACTGGATACGCTCTGGAATGGGTTGACTCCTCCG
CTTTTCTCACCTTGAAACATTGTGCACAGATCTCCTTTGCTCTAACACTAGGAACTCTTTGCTCTGAAGTCATGGACAAAAAAGAAAAATCGCAGCAGCT
TACGTTTCTTGGAGCTATGCTCTTTTCACGTGGGGTGTCTGGCGCACGGTGAGTCTACATGTGCAGTGATCCCATAGGTGGGCTGGGTTGTTGCTGACTT
TCAAGATAAATGTGTCCCAGGGTGGTGTCATGCCTCGATCGCAAAACCATTGCTGGCCACGATTTTAATTCGTTTGGGGCTCATCACGACGGATTCCCTG
TGGCGTATGTCACGTTTGCTTGTGCGCTGGGCATGCGGCGTGACGAGGTTGATCTGCTCGTCACCAAGGTGCGAAAAACAATTCATGAATGGCGAGCGAA
GCAGAGCAAGACTTCGTCTGCCACTGTTCCACGCGAATCTCAACTAGAACAGGGGTCCACGCATGAGAGCAACGAGTAGTCTTGTCTATAAATCTGTTTC
CTGACGTTGTTGGCGCACTCCTATGGCTGTTCCTCTCCCTGCAGACGCAGAGTAC