Description :
Non Conding Region
Location :
Scaffold_1:134957- 135996
Sequence
1039 bases(100 bases per row)
GAGTTTCTTTGCAGTCAATGGCAAATACAGGCCCACATACGAACGGCTCCCAATTCTTCATCACCCTCTCGCCTCAACCGTGGCTCGATCGCCGTAAGGG
TACTGCAAGTTATTGTCTTTCTTGCCAAGTTCACCGATCCTGAAACTAACGTGTACACTGTTCGCTTTTGATGACCTGCAGTGGCATTTGGCCGAGTTGT
AAGCGGATGGCGCACGATCATGACAATCGGGAGTCTGGAAACTCGCCAGGAACGGCCTTGCGTGCCGTGTACCATTGTCGACAGTGGGAAACTTCAGTGA
GGAGACGATTAAAAAGTACTAGAAAACATCATCTCCACTTGATTCGCAGCGCAGCGACTGTGTACATTCAACACCAAACACCATACCATCACTCGGGTAC
AAACTCTATCGCCCAGCGAGCAAGATTTTCTTGCCTTGGTCAGGCACTCGTGCCTATTCTCTGCAGCATGACTGTGCGGCACAGCATCCTTCCAAGACGT
CCATAATCGTGACACCGCAGACAGCGGGGACCCTGACACGAAATTCCTCGCCGACCTGACCCACACCTAACGCGGCAGATTGCGTCGACGGCAGTGTCAG
CATCAACTCCGTAGCGTGCGTGACTGGAGCCTGGAGCTCTTGACCATTGGACGCCCGTCGCAATGGCTGCTTGGGACGCGGGCGGGGACGGCGCCGCCAA
CAACTCGAGTGCCTGACTTCATGCCTGACCATTGCATCATATTTGCACCATCACCAGCTTTAAGATTTGGGCGTTGTCCCTCCCGCACCGATCACCCCTG
TGTATCCATCCTAGCGAGCCGTTACTTCAAGATCAAGTTCTTTTTCCACTGATTGGTCCACGCCGCTTCGCTCGGCCAATCACATGGAGTCGCGTCGCCA
ACAGAGCAGATGATGTCCTTCCAACAGACGAGAAGAGCTCCTCGTCAGACTTGGAAGAACATGGCTCACCCTCTGCAGCCCTACGCGGCTCACTTTTCAA
CTTTCTCCCGCAGTCTCCAGACCAATTCCAGCAGCCCCA