Description :
Non Conding Region
Location :
scaffold_1:134944- 135433
Sequence
489 bases(100 bases per row)
GCGTAAGTAGCGAGTCAGTCGTGGGCAGTCGCCTCTGTTTTCACTATGGAGTCCCTTCCTTTTGCGAACAGAGAATATTTTGAGTGGATTTTCACCAGCT
GGTGCACCCATAACGTTATAAAGGTCGTGTAAAATTTGTGTGGTATCATTTATTGAAAGCGATCTTACTGAAGATTGAAGTGCCTGTATATTAACGTTCA
TTTTAAGATTATAGAGTATCGGAAGGGAACAGTTTTCGAAACCTTACTGGAGATTCAAGTGCCTGTATATTAACGTTCGTTTTAAGATTATAAAGTATCG
GAAGGGAACAGTTTTCGAAACATGCGTGCGATATGCCGGGAGCACCGATTGGACGTTAATCGAGATAGTACGTGGGTATTGGTCAATAATGATCGGATAT
GATTTGGCTAACCAAATATTCACTTGAAAAATTCAAGGTAGCAACTGATTCACATCTACGTTTCGTATCCATTCCCTAGTGTATCCATT