Description :
Non Conding Region
Location :
scaffold_1:134857- 135740
Sequence
883 bases(100 bases per row)
CACACTGATGCGGACAATGGCATGACGTACTACTACAACGCACTGACGAACGAATATCGATGGGAAAAGCCTCAAGACTTCGACGTTAACTACGAAACGT
TTGCTAGTGGACGAAGTGCGAGTAGCTCCGCTCGGAAATGGTTTGAAATGGCCCACCAAAAGGTCAATGATGACGGTAGCAGCGCTCTCACAACTCGGTC
GACAAAAGTTCGCACTCTTGGCAAGAAGTGGGTGGAGCTGGTTGATCCAGAGACGCAGAATTCGTATTACTACAACGAAGTGACAGGAGAATCACGGTGG
TCTCTCTCCCCTCGTAGTGCTCGGGATACATCCGATACAGACGACCAGATCTCCTTGGCTCTGTTCGCACAGGTGAAGCTGCTTCGAGAAGCCCCCGTGC
CATATTCATCTCGGGATCAACACATGAGCTGGCTGGAAGCGACCATCGTTGAGAAGGACTGGAAAAAGGCTGAAGCGATTGTCCAGCAGATTTTCATTCG
CGAGCAGAGCCAAGTAGTGACCGAGCGGAAGGCGAAAGAAGAAGAGACGAAGACTGTGACCGCAATTGAAGTATCGGAAGCAAACAAATCTGTTGATCCA
GCGTCAAATTCTTGGATTGAATGTCGAGACGAAAGCAGTGGCGCTACGTACTACTGCAACCAGGTAACAGGGGAGACAAGCTGGAACAATCCGTCTATGG
TGGATGTCAGCACTGCAAAAGCTTCAAATGACTGGCAAGAGTTGCAGGACAGCAGCGGTAGGACCTACTACTACAACATGATGACTGGTGAAACAACGTG
GGCACTACCGGCATGAGCGGATCTGAACTACAACGTAGTATAACTTTATTTTGCCAGTAACACAACTACTCACAATGGCAACT