Description :
Non Conding Region
Location :
Scaffold_1:134187- 134678
Sequence
491 bases(100 bases per row)
AAATCTTTGTTGAGAGCGTTTCTTTTGGATTGTGCGAATGCGTGCAATCAATAAACAGCGTATTCTATTCGTTGGATGTTAAATGACGCGATGTGGTGCA
AGGAACAAGTGGAGACATTCGCTAGAAATTGCGTGCGAATCGCCGCGATTATATTTGCATTCGAGTGGTACGCTTTGGTGCGTACTTAACGGGTATCGAA
AGTACGTCTGATTCCAGACTATACACTGTATACTCATGTGTCACACACTATGCTCGCACATAAACTGGACGGCGGACACGAGTGCCTGGCTATCGTCCTA
AGTGATCTATTCCTGTCTTCCACACGATTTCCACCAATCTCACACCACTAAAATCTCTTATCGTCCAATCGATGCTGCCTGAATTCCCGCGTTTTCCATC
GCATGCCAGCGATACTTTTGCACACGCTCTTCTCCTTACATGCTTTAATCCTTCTGTATAACTATCGCTCCATCCCTTCCATCACTCAATA