Description :
Non Conding Region
Location :
Scaffold_1:134185- 134621
Sequence
436 bases(100 bases per row)
GGGGAGTGCCTGGGCTGGAGGATCTGACACCTGCAAACATCGACGCGGATTTATCCCCGCCCAGCGGCGTAGATGACGACGGAGTAAACGGAGACGAAGC
AATCGATTTACAGGAGATTATCACGCGCAGGTTTAATATGCAGTCAGCCGCAGCGAACAGTGAGCTACGAAGAGCATTTATTGAGAACTTGTGGGAGCTA
GAAGGAGCACGAAAGAATCTACGTTAGCAGTGCTTCTACATGCCACCGACAACTGGGTTTGAATACCTGTAGCCAAGTTGGCGGCGGCTGCGGTGTTCTC
ACTGGTAGCATCCGTGTTTTCGGCAATAACGGCAGCGTTCGCGTCAGTCCAGTCGCTGAATGATTCTTGGCTCTCCTGCGGTCTCTACAATACATATTTT
CGTTAGTCTTTTCAATTATTTCGTACAGTTTTTTTT