Description :
Non Conding Region
Location :
Scaffold_1:133901- 135253
Sequence
1352 bases(100 bases per row)
GTTTTAGTCCTTTCCGGATGGTTTCCAGCCAGAATCTACAGTCGTGTCCGGATGACTCTACGTATCCGGATAATCAAATGCACACCAATCTGCCACGTAA
ACGTACAAGCAAGTGCCAACGAGTGGCATATCATTGCATCAACTAGCCTTCCAATATACGCTGTATTTGTACCCACTTACAGTGTATTTTTTCACTTGGT
CGCCTCGCACCCAGTCCAGTTGTCCGCTTGACAGTACGCTTATTGCGTGTCGCTCAATCAAGACGCTGCGAGTCAGCGCTACATGCCATTCAACGTCCGC
ACGTGACTTCAAGTTAAACTGATTGGGTGGAAGCGGACCGTCATGCAAACGACCGCGTCCGGTCAGCGACTTTGGCGGGAACCTTGACGATGACAATGTG
TCTACAATGGACGGTGACGACTTTTGGACGGCACCAGAGCTTTTCAAGGCAAGACAATCTCTGTCGCAACATATCTTGATGGACTCGGTTTGCTTTTCAC
CTTTGTCAAAACACTGTATAACCACCCGCGCAAGAATACTACTCGCCGCCTCATGCGAATTGTGGCTAGCAACTTGCGCCCGACTGTACCAAAGCGCGTC
CTCGATGGTACCACCAATTCGCACTGGATTGCATGCACCGCCCGACGGCTTCACACGTCGTCGCAACACTGCATGCGGCGATCGAAGACTTTACTTGAGC
TTGAATCAAGGAGCTCGGTCGCGATCGTGCCAAGGCTCTAGCAATCACGCGCTAGCTCACTGCATGCATATCTTTTGGTTTACGAAGTTGAACACGCTGG
ACGTCACACGCTGCATCAACGCTCGTATTGCTGGTTTCAACGATAACATGCAGAGTTGTAGCGAAGTTGTAAGTTGAAGGAGTCGTCCTTCGCCATCCGT
TTCGCAGATCATTGACGGGTCATCCGTGCACACGTCATGCATATCAAATGGCCGTGCCGCGGCCCAATCCCGCGCCGATGTACCCAGTGAGTAGGGTTCT
GACATGTGCGGGTACACCATACGGTCCCTGATCATTCAGACCGTGCATTTCCTCTTAACCGCTGTAATCTCTAGTTCGCACTCTCTCGACCTTGCAGCGG
ACTTGTAGGACTATGGTCGATAACCATTTGGAAATGCAGCTCAAACGATGAAATATATTGCACTGTCTGCGCTATCCTGCACATTTTTGTTGGCGCTACG
CGGAGTGTTGCGCTCGTTGTACAAGATCACTTCCGATCACAATCGAATACCTACCAATGTGAGACAACTCGTCCCAAGTTGGACTTCGTCTGTCCGCCAA
GTGTCTGCGTCTGGCTCGAGTGCCCATTTTGCATTTCACACCAGTACTCATA