Description :
Non Conding Region
Location :
Scaffold_1:133870- 134110
Sequence
240 bases(100 bases per row)
CGTCTGCGAGGTGGAGAGTACGAGCGAGAACGAAGTCGCTGCTAGCTAGCCCAGAACGAGCATTTTGTTTTTCCCCCACGAATGGTATCCATACGAGTTT
CAATTCAAAACGGAGCAACTCACCAGACACGAGCAGTTCAAGGGGACTTGGGACAGCGCCACAACCTCACAGCACACAGCATTAAACGCTCTTTAACCAC
TTTACAATTGCCTCAACACCTCTCTTGGAGGAGGTCCGCT