Description :
Non Conding Region
Location :
Scaffold_1:133846- 134150
Sequence
304 bases(100 bases per row)
TTGTGTCTTGGCTTATTTTGCTCTGTTCTGACGTTAATATTGGGCTTTAGACGATGGCAAAGACCTGTGAGAGATCCGATCGAGCTAGGCTATAAGCTAG
TGTAGCTAGCAAACCCACAGTGAGAGGCAGAGAGCCGTCAGATGGCAGAGCAGTAGGGCACGTGGCAGTTTTCCTCGCTCCTGAGCTGCGAGTCGGATAG
TGACGGCTGTTCCCCCTTTACACTGCCCCTTATTATAGCCCGAAACTCCCAATCTAAATTTTAATTTTTGAAAACACCTAAAATAAAGCgcatgttgaag
tttt