Description :
Non Conding Region
Location :
Scaffold_1:133800- 134086
Sequence
286 bases(100 bases per row)
TCGGAGCGCTGTTACGTGCTGTGGGCATTCTCATCTGGCGCCGATGTGCGCGTTTTCGAACTATCTTATTCGAGTCGAGTGGCCGAGTAGAGCAGATACG
AGACAATCGGAAATGAACACCGCATGGTGGGTTGTATCTTGAAGTTGATGCTGTGCTTGTTTGGGGTGGTTGTGTATGTTCAGGCTCATCCCATTTGTGC
CGCAAATAAACCTGCGGGGACGCGACGCAAACGGACTGCAGTTGGCATTTGTGCTAGTTTGAAGCAGACAAAGTAGTGTCTTAACA