Description :
Non Conding Region
Location :
Scaffold_1:133471- 133805
Sequence
334 bases(100 bases per row)
CTTGAATTGGTGCCCGCCCGGTCGATGGAGTGTTGTGTGTGTGGATGTGATGGATTGAGCTCTCTTGTTGCTCTCGCAGGCTGATTTTGGCCCGCGCTTT
TTGTTTTTGCGCGCGCTTTTGCGAGTCAAAATAGACCCCAGACGGCTTTTAGAGAGATGTAAAAATTGCGCGCCAATACTTCCTCTTGAAGTCGCTTTAA
TAAAAGCGCGATCTTGGCTCAGAAATTCATATTTAAAGCGCGGTGATACTTGCTTGGGGCTGTTTTGGGAGTTTTGGCGGGAGAACCAAAAGCAAATTAG
GCAATAACCAGCCAGCAGCAGCAGGAGAGACAAA