Description :
Non Conding Region
Location :
Scaffold_1:13344- 13822
Sequence
478 bases(100 bases per row)
TCGGTCGAGGATTGGCTGTTATCGGTGATGGATAACTTTGCCATTTTTACCCAATCGAACGAGCAGTGCCGCAAAAGTGTGGGCCGCATACAAACAACAA
GTCGGTTCGATCTTCCCATCGTTTTGACAAGCTTTGCCTCGTCGCGCGAGGGGAATTGGCAACAATAGCATGTAGCAGTATGTAGCAGCGTGCCGTGATG
GAGCAGGATTCCGCTATACAACTACAGCACCCCCGGGCATAGTGTCCTGTTGAAATGCATACACATAGGTTCGCACTGCAGCGCACAGCGCGGGACAGGC
TTTCATCCATCATCTCGCTGCGCTACTGTGCGGAATGATTTgatgcagcgacgtcatTGGTCGAGAGGGAGGGGGGATTCGCACTTAGCCGCGTACCCAG
CAATGCGCGGTTTTGCGGCTGCTTGGAGCTCTCCGTCAGTCCTCAATCCTCCACCAAGCAGAAAGGAAGCCGTACCGA