Description :
Non Conding Region
Location :
Scaffold_1:133310- 133509
Sequence
199 bases(100 bases per row)
GGATCGATCTATGCGAACTGACGCGTCAATGACCAAGCCAAAACGAAGACAGGATTGCAGCCAATCGAACGCGTCCTGTCGCGGTTCGCAGCCAATGAAC
GCACGGCCATCCGTGACAGTGATACACGGCGAAGAGCCAATCGCCGCCCTGGATTGTGGCCAATCAAAGCCGAGCGCAAGATACGGTCGATGCAAATTG