Description :
Non Conding Region
Location :
Scaffold_1:13323- 18133
Sequence
4810 bases(100 bases per row)
GACGACGACGAGGAGGGGGAGATGGTCGACGGTAGAAGAGCCTATTGATTCATACACACGTGCATTTTTGGTAGTAAGGTGGGGTGGGTTATTCTACGCT
GCGGGTGAGTGCGCTTGCTGCTGTTTGGGGCGTTGACGGGGGGCGTGGTGGTGGCCATACGCCTTCCGGATCTGGAGCAGGAGTTGGAGGATTACAGCGC
GGTCTCCGGCGTAGATGGCGGCGGCGCGACGGAGGAGGTGGAGAGGCATGGTCTTGAAAACAGAGGAGTGTTATGTTAGAGCTGGAGGATGGGGATGGAG
GAGGGGACGACTTACCTTCTTCTGCTGGAGGATGGCGAGCGCCTTGGTGATGTTGTGCAGTGAGCTGGTTTTGCTGAGTGGCTGCTTGCCGGACGGCCGC
GTGATTCCTGGGATGCTGCGCATGAGCTCCACCTTCTCAACGATGCAGCACAGCAACACGCCTGACTGGAATTCCGTCAACGTCGCTGATGGATCCTGCG
CAGTTGTAGGATAGTGTGAGTTTTGGAGTGACGACTAGTGTTGATGCGATGCTGCATTCGCACCTGGAGAGCGGAGGCGTTCTTGAGGTGAATGTTCAAG
CCTTTCAGCCACGACAAAATCTCCTCGACAGGTTCCCGCGATAATGCGGAAGTCGAGCGTGCTGGAGCTGTTGAAGCTTTGATCGGTGATGGCTCTACAT
GTATCAACCCTTCATTGCTTCGGTCGGTTGTCTTGACTGGGGCTACCCTCGCCGTCTCTTCGCCTACACAAAATTGTTAGGTGTTGCTGTACACGGCCAC
AGATCGATCAAAGTTGGCACGCACCTGATAATTCTGACAGTGCAATGCTCGGTGCTCTGAAAGCGGATTCATCTTGCCCAGGTTTGCTTGGAGCCACCGC
AGCGGTGGTGCTAAACTCGGTGCGGACCGGCAATATATCCATGTCCTGGTGGTTCAACTCGTACTCGCGAGCCTCGAAAGATCCAGGGTGAAATGGCTCG
CTGTATACTGGACTCGAGAAGGGTGCCTTTGGTACTGGAAACAGATCATCGTCGTCATCTTGCGGGTCACTTTTACTCCATGCAAGACGGCGCGCAAAGC
TTTCGTGCAGCTTAACCTGAACTAACGTTGCGTGGTCACCTTTAACAGCGAATTTTCCATGCTCAACCAGGGCCACAGCGGGGATATCCAGTTGCAAGGG
AGAAGGGTGTACTGGACTTGGCCCCTGACTCGCTAACTCCTTCTTCTCCCTGGATCGCGGGTTTACCTTCGAGGATTCATGAACCGCGCTATTAGCGAGC
GAGTCTGTCTTACGCTTCTCCCGAAAGAGTTGCCAGAGGTGCCACAGAATCCCGTAGCTGACTTGTCGATCGCCGATGAGAACAGCCTGCTCTGCAGATG
CAGTCAAATAACACGACGGGATCCGTCCACCTGGTAGCTCGCCAAGTTTTTCAAATGCCTTGGAAATATTTTCTCTAGTAGAAAATAGCAAACAAATGGA
GTCGATAAGTAAAACTCCATCCGCTTGGACAACAGAAAATGAGTCACCCTACCGCATCTCCGTCAACGTTCGAGGAGTTTTGAAAAACGGGAAGGATGCG
CTCTTCACCACTTGAGTCAATAGCGCACTACAAACAGCACGGCACAGATACTTCAGTATACGACTAGAATGGAGCAGTGCTCTATGAACATCGGATTACC
AGAGCAAGGAACCGTTGCGCATCGAATCCAGCAAGACACCGCCGGTTGGGGCCTGCGAATTGTACAAAGCGTGTTAGTCTTTTCCAGGCAGCAGGCTAAC
CCAACCAATATCTTACTTTCTTCGGATCCAGACCGGCAAGCGTTAGCCATTCGTTCACTGCATGCATCTGTTCGTTTGTGATATAAGGCAAGTTCCGCTT
TAATGGAGCGCACCCGACGGATGAAGAATCTAAGAGCGCAGGCCTCCTTGCTTTCCTTTGACGTTCCTGGGCGTGCGTGGGACTGGGACCATCAGTGCCT
TCGACATTGTGAACAGCAGTATTTTCATCGTTGTTGGCAATAGTGAGGCTTTTAGCGACATCCGATTTCACTGGGTGGGGTATCTTCGAGACCTCATCGA
CGTGAGCAAGTTTGTTGACTTGATGGACGAGGTTGTCCAGAGCACCCCACAACGCCTTAGATGAACATAGCTTCCCCGGACACTGCAAATTTTCAAAGCA
GGCAACAGCTTTAGCAGACACCCCGAAGAATTCGAACGCAGCCCGAGCTAATGCCAAATTGTGCCGCCGGTCAATAGGCGTCTGAGGATCGGCTATGGCA
GCGAGACCGTCGAAATGGAGTAGCTTCGCGTCAGGAACACTTTGTTTAAGTTTCTTGCCGTACCGTTCAAGGACAGCGAAAGCGATACGACACAGCAAAA
CTCCATTAGAAAACACTTGTCGAACGCGTCTTGGTGAATTTAATCTCCACTTCTTCGCCCGTATTACGAAAATCTGCTTCAGAGGCATCCCAATCTGCAA
CGTTTGCTGCACCCACTTGCAAAATCGCATCGCAAGTGCATCCTCATCGGAGCTATCAGCGTGTGGGCTCTCGCCTTGAGGCTGGTATTTTGCTATCGGA
TCCAACATCCCGAACACTCGAAGCCCACGCTCATCGTGAAAAATCTCAGACTGGGTAGTCTTTCTTGGGTTTGTACTGGAGGCTAAACTGCAGCGAGGAC
GGGTACGAGATTTTCTCTTTACAGTCGTCGGGCCTTTGGTACTTGGCCTTGGCGCTTTTGATTCCGTTGATAACGACCCTTTCCTTTGGGCGGTCTTGGA
AGACTTGGGTGCGTTTTGGAGGACATGTGGCCGGCTTCGAGACGACTGCACTCGCTTGTATTTTTGCTTGGGTTGGACAACCTCCTCTATCACTTTAGGA
GGCGATCGGGGCTGCTGCAGCGAGTGTTTAATCATTTCTTCTTGGGCACGGCGACGGTGGAGAGCGTCTCTATCGCTTTCAATCGACTGCTGCTGCTGCA
TCCGCTGAATGCTGAGTCTCTTCAACACGGTGAGCACTGCGCAGATTGCTTCACTGCTTCCCTCCATCATCTGCGCCACACACTCCGCGTCGTTGACAAT
GTACATGGCATCTTCATCCTGACTCCGGCATTCACTAGCAGCAAACTGGACAACGCGACGAAGACGCTCCGCAACGGCATCAGCGGCCAACAGATCGATC
TCAGCTGAAGCTTCGGACGCAGTTCCTTCATCACTCGAATTGCTCTTCAGATGCAACGATTAACTGTCAGCAGGGCATCAATCGGCATGTCATCTACCAA
CTCCGTACCTGCAACCACTGCACAACCTCAAAGAGTACATCTCCGAAGCGCAGATCACGCAGCTCCTCGACCAGCAAACACTTGGTGAGAGGCAGCGAGT
TGACCCAGTGAAGCAGTAACCTCTCGCGTACGCCTTCACTGCACTGTTCCCCCTCCGCGGTGACAACCGAAAGCCGAGTAGGAGACCCACAGCCTTCACA
GCGGCCGACCGCCTCCATGCTCGACATCGATCTTCAAAGGTCGCCAGTCAGAAAAACTGCTATCAAACCTTACCAACTTCGGCCAGTCCACCATGGCCGT
GAACAATGCGACGAGTGTCGAGGTGACCGGGAAGCAGGCCCACAGGCACATCTGAGAGCTGCTCCTAGCAGGAGGAGGCAGATTTGAGGAGTGCTGTCTG
CAGTCCTCAGCTGAATTCGCGGTGGCGCCAGCTACTTTTTATCTCGTGCAACACGTTGAAGCTGCCGCATTCGACTGTTGAGTCCTCCAGCCCGCAAACA
TGAGCCAGAGCCGGACGCCGAGCATGAGCTTTGCTGTTTGAAAAGTTTGCTCGCTGACGTGTTGGTCGAATCCACCCCATAGACTGAACATGGAGAAACC
CGAGTCGCGTCCATGGCTGGGTCGGTCGGCCTCTTGTGCCGCTGGTGACAAAAGTCGCGGTTCTTCTTGCAGTGCCGCTGACCGGCGGGCAAGAGAAGAG
TTCGCGTGAATCGTTTCTTGCGTTGGGGTCGTCGTCACGGCGGTGACGGAATCGCTGCATGGAGCGTGGGGCCCCTCGCTCAGCCCAGGAGAGGAGAGCC
TTGAGCAGATCTCCCTCCACCTTGAAGGAACAACGTCAAAGGTGTATGCGTTGGGGAAACGTTTGTCAGAAGCGGTGCCTCACAGCGGCCTGGTCACGTT
TGAACGACATACACGTACTGACACTTGTTTACAGTAAGCGCCCCACGTCCGGTACTGGTATAAATTAATATCCCGAATAAAACGATGTAATCTATTTGGA
AAGGTTTATTTTTACTAAACCCTGGCGGGAGTTTTGGCGCGAACTACTGCACACCAGTCATTGCCACAGAGCAACAGCAGCCAGCCCGAAGCAGGTCTTC
ATACCAGAATTTTCACTGAGCCAAACAAGTACAAGAACGCCAGGGGGTCCTGAATGAAAATACATCAGAAGCGAGGCCTCATACAGAAGGCAGCCGACTG
CCCACGATGTCACAAGCAGCGCTCGCAGCGTGGACAAAAGCACACTACAAACTCAAGCGCGCACCAGCCCAGTCGACCGTGTCCGACATACTCAAGAAGG
CTGCGTTGATCATGAGCAAGGACTACGGCGATGGTAACCGCCGCAAGCCCCTGAAGGTGACCTCGGCGGCGCTGGAGGCGCGACTGTGGGCGTGGATTCA
GGCGGTGGAGGCCCAGAACGTCTGTCTGTCCCGCGAGCTGATAAGGATGAAAGCGATCGACATTCAGCGTGAGCTGTGCGACGCATGGGACCTGGGGTTT
TCCGACGGCT