Description :
Non Conding Region
Location :
Scaffold_1:133042- 135020
Sequence
1978 bases(100 bases per row)
GGCGGAGATACTGCAGCTGAAGAAGGATGCGCATCTTCTACGGGAAAACAGGCAAGGGACAGCTGACCTCCACCCCAGCGCTCGATCAGTCAAGCGCATC
CGAAGCCAAACTGAAACGGAGCCATCGACAACCCACCCCCGAGATCATCCGACGTCGCAGTAGCCGTCAGATTTTGCGGCAATCACCGCACAGCGGCGGT
AGCCAGTGGGAGACATTGAGGCCAGGTAGCGAGTGAGTGCCGTTTCGCAACATCCATTCGGACATTTTCTTGAAGTATTTTAAAATAGCGAACTCTCATT
CTTTTTTTTTCATCACAATGTTGTTATCCAGAAGCTACAGTACTTATGACTCGATTTGATGAATGGCATAAAAACCTTGGACGAGCGCTATCTAGGTAAT
GGAAAGTTGTGTTTCGACACCAAGTGGACTCATGCCGAGATGTATTTATCCACTTCGTTTTGCTCAGTGCAATCAATAACTACCTTAAACGCTCGGTGAC
TCGTGATAAAGGCTCTCCTAGTCATTACAAGTACTTTCACATAAAAATAACTGAAACCTGTACTTGAATTGTTGAGAATGGAGGACATTGTGATCTGTAT
TTGCATATCGAAAAGCGAAACGCGGACTCGCAACTCACTTGCAAGTAGAGACGATCGAAAACTACTTCGTTTGGTGCCTAAAATCCGAGCGAGCTGTCTT
CAGATTGAGACGACAAAGCACTGGTTGATGACGAGAAGCTATCCCAATCAGCGGCCGAAGCACTGTCATCCCAGGAGATGCCTTCCGAGGCAGAATTCGA
CTCAACAAACCAGCTACCCACCGAAGCGTCAGTAGAAGCAGATCCCGAGGGCAGGATATCCAGCGTATTGTCTTCCGATGCGCTTTCTGCATCCGACGCC
GAATCGTCAAAGGAGCCGAGCAGCGAGTCGCTCGCTGAGTCTTCAAACGGGTTGACCACGACGTCTTCGAACGTGGAGGAGGCGATACTGCCAATCGAGG
CTTCAACCGATTCCTCGACTGAGTTTGAGCTATCGTCAAGCGCACTTGAGGCAGATGAATCATCCGAAGCGCTATCGGATGGGCTTTCGACTAGCTCATC
AGCGGCAGAATCGCTGTTGGAGTCATCGTGCCACAGCGACCCACTGTCGATATTAGTGGCCCCGAGACTGCCAGAACCGTTCGTTGTCGCCGCTCCTGCA
ATGTTCGTGCTCGCTTGATTCTCTGTATTCGCGACGTCGCTTTCATCGGGCGACGTTCCTCCCATCGACACAGCGGCAATGACGCCGAAGACCACGCCAC
ACACAAGCAGCAACGCGATTGCCCCCCGCGTGCTCCACGGTCGCGGCGACGGGACCGGAACCGACCGCAGCACTGGGTATCGCGTTAGTGCCCCGCCTTC
CATTTCTTCAAGTCGGTCAAACGCAGCGTCGTTTGGATGGTACAGGAGGTTGTTGCTTTCGGTCATCATGGTTGCTGTTTGCCTTGCTTGAGTTGGACGG
CCAGGCCCTCCACGTAGGTTGTGCGTTGAGTATGAACTGCTTCAGTCGAGTGGAGAAATGGTCTCAGCGCCGCCGAAATCCATCGAGTCCGTTGGAAACG
ATTGAGCTGCGATGTTCTCCAGCTCTCCACTTCCCATAAAGCCTCAAAAATAGTCGACACATAATGGACATCACGCTGCATATCCTGCCCCACTTGAGCC
CTTTGCAAACCACTCATCCCATGCGTGTAGTAGAGACAAGGAGAGCTACGAAACCAACACGAGACACAGCAAGCAAGGCTGCCACAATTCAACCTGCAAA
TCTTAGTGAGTACTCCACTTCAACCCAAATTTTACAATTACTCGCTCACTTCACCAATTTATGTGTGCTACACCGATCTATTATCACAAAATGAACATAT
ATTTCCGTACCTTTAGTCAACCAGTCCGTGCCCTAATTCCTGAGCTCTTGGCCACATACTCAGTATCAACCTCAACAA