Description :
Non Conding Region
Location :
Scaffold_1:132947- 133111
Sequence
164 bases(100 bases per row)
CGCATATCCGCTGATCAACTCAGGAGCTCCTCGTGGGGGGTAGAGAACTGCACCAGATATTGAAGCCGTATACTACTATACTGTATGTGAATTGGCAATT
AAGTAACGGTTAAGTAACATCATGTTGAAGTGCGTGTGTCAATGGGAGAGTTGAAGTCGCTCAT