Description :
Non Conding Region
Location :
scaffold_1:132709- 132950
Sequence
241 bases(100 bases per row)
GTGACGGATCTGGTGCTGATGTCTTTGTGTGAATGGCGCTCGTGAGCTCAGAATTAACCTTTAACGAAAAGGGTTAAATAGTGAACCGGTTAATGATTTG
AAGTAGGTAGAGTGCATCAAATATAAAAAACCATGAAGTTTCATTGGGTGGGTGTGGACACAGTGCTACTACCTGGTAGTGCATGTACCACGTTCACTAC
AACATACTTCTTCGAAGTACCAGCAGGATCTAACACCACTC