Description :
Non Conding Region
Location :
Scaffold_1:132535- 132996
Sequence
461 bases(100 bases per row)
TAGTGTTGCCGAGAAGTATCCGAAATGCGAATGGAAACCTTGAAGTTGCCGTCCGAAGATAAGCCGAAACTGGTGTGGGCCACCCGAGTTTCGGGCGATG
TGAAGTCTGTGCTGTGACACGCGAGACGTCACCGACCGTCTGATTCTTGTCTGGTGTCCAGACACGCGACTCGAGCACCAACACTCCTCCGCCTCAGACC
ACCGTGAAAAATCTCACCCAACAGAGCGCTCTGGCGTATCCGGACAGCGGTTGGGAACAAGAACGTCTGGGGAGATGGCGGACGCCGCATAGCCGCCGTC
AGTTCAGATTTCTCCGGCCGAAAGTCGCTCGTTCGCTGTGTTGATCACCAAATCATGTCGATCCACATGCGCACCCAGTTCCGTGAGTGACGCGTCTTAC
CCGCTGCCCAATGCGTTCGACGCGGTCGACTCACAGATCGGATGGGATACCTTGCCAGTCA