Description :
Non Conding Region
Location :
Scaffold_1:132390- 133589
Sequence
1199 bases(100 bases per row)
TCAAAGCACAGAGGACCGTTAGCTTTTCAGCGCCGAAGATGATTTGCTCGCGCTTGGTCAAGCACGCTGTGCCAGTTGTCCTCTGTCAGCGCGACTAGGT
CTCTTTGAGTTGCTCCAGTACTTGGCTTGCCGTACAGGTTTATGTCTGGGCGAAGAGTACGAGCCTCATAAGCTGCTAGTGCTGGCTCAACGATTCTCTC
TACTTGCCCCCACGCCCCGTACAGCTCTTCTGGGTTGAACGGGAACTCAGGGTTGTCGATGCGCACCGTCGTTCTGCTGGTTTGGGCGATTCCACCTAGC
TTCACTGTGACCCGAGCGAGTGTGTCCATTGTGCTGTGTGTTGGGTGGTCTGCAGATTTATATGTGCACCGAAGCTCGGAATGCCGACGGCGAAGTCGGC
ATTTAGGCTTATTAGGGCATCTCCACCGCAGCGTCTCTATCCTATCATCAAATCAGAATAAAACCCTGTAACTGACCATTTGCAAACGACAGCAAATTCA
CTCAGTCGCACCGCCTGGTAGCAAACTGCGTCGTGCCTCTGTCCACAGCAGAAAACCTCCCCCAATGAGTAGCGACTCGGACGAAGAATCGGTGCTCTGC
AGCGGCAGCGACGACGATGAGGTACGTGCACGGAAGATCTCATGACAAGTATTTACATCTTACTAAGCGTGTATGTATGTATCCCATGAGGCAGGCGTTC
TTGCTCCTGCTTCTTTCTGCGCAGAAGGCCCCCATTAAGCGCAAGAGAGGTGGCTCGGAGCCTGGCAAAGCGGCGAACCTCGACCGCGATTTCCAAGCTG
CACACTTGCGGCTATGGAATGACTATTTCTGTGAGAATCCTACCTACCCCGAGAAGCTCTTTCGTCGGAGGAACCGCATGAGTCGCGCATTGTTCGAACG
CCTCATGGGCGCTGTTGTTGAGCACGATGCGGACTTCGAGCAGCGAGTCGACGCCGTGAGGAAGAAAGGTCTTACCCCTCTTCAAAAGTGCAGCGCTGCT
GTTCGGATGCCGGTATATGGCTGCGCCGCAGATTCGCTGGATGACGTGAAGGGTGCCGAAAACACACTTTTGGCTTACACTAAGAAATTTTGCGGAGCTG
TAGTTGAAGTTTTCGAAGAGGAGTATCTGCATGAGCCTACTCGTGATGACATTGAGCGACAACTGGAGAGTTCCGCTTCCCGCGGGTTTCCTGACTGCC