Description :
Non Conding Region
Location :
contig_20:13230- 13396
Sequence
166 bases(100 bases per row)
TCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTTGGGTCTGGTTCCGATGACCAACAATTCGCTGGACGATCC
AGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGTGGGGGGGGCGGGAAGACGCCCCGGGTTTGGT