Description :
Non Conding Region
Location :
Scaffold_1:132197- 132409
Sequence
212 bases(100 bases per row)
GCGCTCGACTTCTTGATTGCTGGATGTCTGAGTTGTTACCTGTAGTCTCGCGCGGCGAGTGTATCAATGGGCGGTTACGCTAGCTGGACAAGATGTGCCC
CTTGACGCAGGCGTATTTTCAGCCAATTAGATATCTATGCGATTTTGATTGGGTGATTTTCAGTGCCGTATCCAAAAAGGGGAGAACTCGATTCGAAGCA
GTGAGGCGAAGA