Description :
Non Conding Region
Location :
Scaffold_1:131585- 132663
Sequence
1078 bases(100 bases per row)
AAGGTCTAAGACGTTGGAACGCCGTGATGCTGGCATGCAACTCGTATTGATACGAGCTTGCGTTTGGGATCGCAAAGCAGCTTCGTGTTGGTCACTGGTG
TCGCTCTACGTCAATGAAAACGTGCTGGATGATTGGCTACATTTCTGCGGGCAAACTCGACAACTTGAGAGCTGTCATGTCGCGTGACCAGCCACTTGAT
ACTCCATCTTTCGGCTGAACATCACGCAATTTTGAATTACCGACGGCGTGATCGTCTAGATGGGCAATGTGGCGAGTCGAGCTTCGGTCCTTCGAGAGCG
GGCGGCGGATGCGAGGTTGGCACACGACACGTAAGCTCAAGACAATATATTGTAGACTGGTATGCAGAGAAAAACCTGGGCCACTGATCGAGCAGCAGCT
GAGCGAGGCGAGACGGGGCGTGTAAAACGAAGGACGTGGACTTGAACTGGGGTTGATACTTGGTTGATATCATGAGTCAATATTGACCCATGTTGATATG
CAGCGTATCCGGCGTGGTTAACCGCCACAGCAATGGCCTTTGATGGTAGGTACAATCTCGCGCTCTGCCCGTCACGCGGCCGTACCTTCTGATCGCGTTT
GGTGGGGGACGTCGGGTGCGTCCTCTTACGAAGCAATGAAGTGTGGTGGACCCCGAGCTAGGCGCTGACGACCTGCTTTTCGACGACCGCACTATCGCCG
AGATCAACGTCTACGAAGGCCACTTTGGTGCGGCCGACTCGCAGCTGTCGCATCGCTGTCGTGCCCAGAATGACAAGCGCAGAGACCAAGGGAATTCACT
TCGGGCTGAAGTGGTCTCCTGCTGGATGGTGTGTACCGTTGACAACCGCGTCTCTACGCGCCAAGTCGCACCTTCTCGGGGCTTCGAAGGGGCAAGCGAT
GAGCTCGACCTGTCGACGGCGACACAACACGCATTCGAGCCAAGTATGAATGTATCAATCAAAGGAAAAATTATTCCGTCGGAATCAAGAGACTCGTTTC
TGTCTTGCGACTGTAACCAACAACACTACATTACTTGTTATGCACATGACATTTGTCGTAGCTACCACCAAACATCTT