Description :
Non Conding Region
Location :
scaffold_1:131415- 141134
Sequence
9719 bases(100 bases per row)
TTTGTGTGTGTGTTCTGCACCAAGCAATGTAAATCCAACAATAAGGCATCTTCTAAGAAGTTTTGGTCCAGTAGTTGCAGACAGTCCAAACAAAACAGCA
GGATGTTTGCAAATATGACATACAGTGCTGTCTGCACTAAATGTCGTAATCGACAGGCGCAGATACGAATATGATCGAATCCATGAGAGCTAGTTGGTTC
ATTTATGATTTAACGACCCATCCCAGGTAAAGGTAGTCCCCACATCTCGTGAATTTCTGAGCTTGACAATCATGTTCTAATGAATGGGTCAATACGATAG
CACCAAAGCGTGCCCAGTTCTTTTTCCACCATCGATGTGTCATCCAAACACTGAAAGGCATTGTTTAGCCTTTATTCATACAGTAGCCTGTCTGTTTAAT
AAAAGAACTGTACATTGTGTCGTAAAAGCTACATTTTTATGATCTTCATATACATTTGACATTAGTATTGCCTCGTTCTCACGACTGCcgttttgttttt
ttaaacTCTGTTTCTTCTGATAACAAAGCCTGTTCGACTATATATTAAATGTAGTATTTCTCAACTACTGTATGTACACTTTGCAATCCTGTACCCATAT
GGACATGATTGGACGATCTTGCTTCTAGGTATTGTACCTTGCAGCTTGCGTCAGCTGCTCAAAAAGTAAGCCGGAGAAACATGAGTGTGGAATGATGGAT
TGTGCTGAAGTTGCTTCGGAAATAAGCTTGGCTTTGTGTTCGATTCTGCCCAAAATTCTCGATGATGAGCATAAATGGCAAAGTGATGTTTCTGGCTTTT
CTTACAAATTTAATTAGAAGACAACCAAATATAAACGTAAGCGACGTCTTACAATAACAACTGTTCAAAAATTGCAATATTTTCCAATGAAGTTTAACCG
TTACATCAGGAAGAGTAGTATGCCGATAAATGCTCAAATATATTGATCAAGCTCTTTCctcaaattattttttattgTGATAAAATACCGGCTACTAAAA
TTCTGGTAATTAAATGTTTTTATGCGAATTAATTTTCCGATGAAAACTCTAATTTCCGATACTGCTATACCATATAACGTTAAATGAACCCATTGCATTT
ACTTCGAACGATCGTTAGATAGATTGAATTTAAATTAGTCTTGCCAATCGGCACCATACTTGATCGTTTTGTACATTTATGGCAACTTATATCGGATAAT
CCTTTCAAATCGCTTAAGTGCACTTGGCTTGTATTTGGATCGGATACACCTACTGTCCCTCGGCGTACCGACTTTCATTTAATTTCTAAACAAAGCGATA
CACCCTTCTAAAGAGTTAATTACAACTTTGTAGTTTCCTCTCACTATTCTCAGTGTCGGACGCTTTATTTGCATAGAGTGTTTGACCTACGGTATGGTTC
GTCTTATTCTTAGTTTCTACCACAAAGTCTGCCCCGATCCGCCGAGTTTGCTGCTTCTGGGGTTTATTTTAGTCTGATGGTTAGATGGGATAGCTTCTAT
CATCTTGATGAAGCCCGCACTATGTTTGAGGGGTTCCAGGACATCATGCGTCCAAGCAGACTTTCCGTCGGTTGCTTTGCCTGTCCATCTCACGGAACAA
CTCGAGGTAGCCCAGCAGCAGCTAAAAAACGAGCTACGCGCAACACCCCATGAGCGGAAAAAATGTGTTGAGTGCCTTTCCAGCGTATGAAATGTCTCAA
GCGTGAGAATCAACTCACGGGCAGCAAAACCTTTGCACTATAAGCCTGTAAGCGCGGTCTGTATGACAAACAAACTTTTAAGATTGACCTCAAAAGAACA
AATAAATCACGCCACTAATATTGAAGTCAAATTGCCGTGCACCTCGCACAAAGAAAGCTTCGTGACTCTCAGAATACATAAAAACGAAAAAATGATGAAG
TATTTACTTTATTATGATGTTCTTAATCATCATACTATTGTCCCTTGGACATAAACGACTTGGACAAAACAATGAAGAGTACCTCGAGAAGAAGAATGAA
TGATACTTGGTGGGTATGAATGAGAAGAGTCTTTGGTCAAAACCGAAGCTTTGGCGTTTCTGATCCCGTTACACATGGTTTGTTTTGTCATGGAGATCGT
CTTCGAAAAAGAGACCTCAATGAGCGCCCTCTTAACCTGGAGATCTTTTTTCTTACTCCACGCGTACCTTACAGTAcccgctctcatgagcataGTTGCA
CCGTAAGAGCGCTCCATTACGTACTCCCGTATAGATCAACAAGCTCTTGGGGAAGGTGTGGTCATCACGGCACAGCAAGATTTACTGCGACTGTCAGTTA
TGCATGGTGTAATACTACATTTTCTGCATGTTGTAAGGCCGGCAGCCCACAGGTTCCATGGACATATTCGTTGCGTAGTCCAATCGGCCGACAACCTTAA
AGCCGCACTTGGCGCCGCAGCCGAAGTATCTTTCGATGAGAGCGGGCACAGTGACTCTTCAAGCTCCAACCAGACACCGCCGTCCTCGGCGAAAGGCGTA
GAGCAGAACTATTACCTACGTCCACAAAGTCGAGGCATTCTTACCTCACCACCTCATCGCTGCACGGGCTGCACACATTGTGAAGAATCCCTCAGCGGAG
TATGTTACGCTACTCCGCCGTGCAATTCGCGACAAATCTATATATATTGCATTCGAGACTAAATACAGCAATGAAGTACTAAATAACATGAAAGGTTATC
GGCTCTGCTCCTAATGAGCAAACTAGCTCGATTTCTGCACATTGTTACTTAGATCGATTGAAATCAAAGATTTATCTGTGTATGGTGCGCAGAAATTACT
ACACTTAATAGAACTCTTCTTAACCCCACAACCAGCGGTATAATCTGTGATGACGGAACACGATATGTTTGGTAATCGATCCTCGGGACAGATTTTGAGC
TCATCGTTGGTCTAAAACGAGTGAGGGAAATGACGGCCCGAGGGCCGAAACTTCTCGCCGATCACCTTACCAAAGCGCTAAATAGACAGCTTTAGGTCGG
ACGCCGGTACAAGGTAAGATAGCGCCCACCGCGAGGCCACTGATAATGCGAGTTTGGCCTTCGAAGGGAGCGACAGAGAAAACATTTAGATTTGGCGAGG
GAAGCTGAGATGGCCATAAATTCGACCATGCTTCAGCAACCGCGCACTGCACTTGTAGTGTCCAAACTATTAAATTGCACTTAAGAATGGGTGCTAGCTT
AAATAACCTCGCTAAAAGAAGCACTCCGCATGGGATCAGCCTAAGTATGATGTAGCCGACACGCCATAAAGTATGGATAGACAGTTTGTCAATAAAGTAA
GATGCAACGCACcttttttgtttgtggagctttggcgagtcgcAAATCACCGCTTTCGGAAGGAAATAGTGTAGCCCGCAAAGCTACGATGGCTTCTGTG
CAGAACATGATATTGTCCAAATTGTATGACATTAATAGTGTCAGGGATCTGAAGCAGATTTATTTAAAAGCGGTAATTAGCCGCTGTATTTGGATTAGAC
AGACTGAAGCGATCGTATATGGCGGATCTTACCGCAAATATTGGCCTAGACACAGGGAGGCGACAGTAGGTCGTGGCACGCAGAGGCGGGCGCTGGCGGA
ACGGTGAGAAGTAGGTGTGAGCTGCGTCCTTGTTTCAGAAAGGGTATTATTGGAGCTGTAAGTCGCAAGGAGATGGTTCAGATCTTTAAATTTTGAGAAT
TGCTCTTCCGCTGTGATGAAGAAACTGTCGAGTTAGTTTTTGAGTGTAACATGCCCACCATGAGAAACCGTGAATTTTCGTGGGTGGCGGCGAGATAGAG
TATTACTCGTGACAGAAGTGACCTGTGCCATTCTTGAGTTTGTAAGTCTCGCTTTACCATCCCCGACCAAAGCCCGCATTGATCCAGAGAAGGTTTAGAT
AGACGGCTATTTTAAGCGATCCGAATTCTATTTATCCCATGGTGAAAACCTTAAAAACGTGTGGTGACACGAAATTCACGACGCATGGCAGGCAACTCAG
AGAAGCATCGCGATGTTACCGCGTAAGTACTTCGGAGACGTTAGGAAATTACGCCATTCAAATAAAGCAGTTTGTCTGATCATGTATCTGCAAGATGTCT
GCGCATATATCCGATTTGGTTCCTAGCAAGTTAAACAAAGCTCACCACAAATTTGCTGTAAGACGCAGATCTCATTCCGACTGAGTGAGCCATGTTagca
aaattttcatgtCGGAAAACGGTGTTCAGTATCCGAACTGATTGCGGTATCGCTGAAATCAGCCAAATAATGTATATTGCACGGACAAACAACAAAGTTC
ACAATGCCGGTATTGGTGGACGCGTCTTTTGGATAACCGAAGCAGAACAAGCTGCCAGCACTATGCTTGTACCAGCAGGCTGGCCGAAAAAGCACATGGT
CCGTTTACATAATACACACAACGCACATCCATGTGCTCACCCATTTGTATATactgacgtcgctgtgcacTAAGCCAATGATCTGTACAGACTTAGGGCG
AATCTGGTACACCCTGGTCTTTGTGACGGGCGTTgcattgcaagtagctgctTGAGCTGCTTTTAAAAGGATAATTTGATATTTAAGCTGATTAAGCTAA
CTCATGTAAGATTCAAGCTAACGAGAATCAAACGCAATCTCGTCTTCATCCCCGTTGACATATGCTTTGAGTAAAGTGCAGTTTATTTTAATGGCTGAAT
TGTCACAGACAGCATGAAATGAGCGATATAAATTTGGAATAAACTTATTAGGGGCACCCATAACGCTTAAATCGTTACAGGCCGCCTGCAACCAGTTTAT
GTGACTTTTGTCTCAAAAAGATATATGGGATATTCTCCCACGATGATGCTTTTTGCACTGTACTAAGTTTTAAAGGTAAACAGGTTAAGCCTCTTTCTCA
TGTATCTTAAAAACGGAGGCACTGGTCAATCTATAATAATCTTTATCGTTGTGACATCCACCCCAAATCGTGCTTTACAAGTAAACACTTGATAGAGAGA
CGTTTGCTAGTGCCCCAGCTAAACTTGTTGTATTGGCAAACAGCATtcgcactcgagcaccgcctGCGAGTGTTCTATATGTttcgcacgactatgaaag
AACAAGTTGTGAAAGTAGGTATATACCTAGCCATGATGTGGCCCGAACGGCGGTGTCGCCAGACCATTGATCAGATCTATCGCGCTAGGCAGTTTCTGTG
GGAAACTCATCCATTATCGGAACGCATTACGCCGTAGTGATAGGGGTATCACTGCCTTAACTTTGTAGCTAATTTCATCACTCGACCAGGCCAGGAACAT
TATGCAAAGCGCAGTCGAGCATGCTACTGAGCTGCACATTTTCGCCAATAAGCACTGTTTGCGCTGAAAACGTTCTGTATTATTGTAAGCCAACACAGTT
CGtcttttgtcgtttccctTCTTAAACCGCGCCGAGTGTGAAGATGAACTTTTCTCACCAACCTCGCTTTGCGCTCGACGAGGgaagaaagcgtcaatga
cgtcacacagaTCCCGCATTGCCATGTGCGCAATATTTGATTTAGAAACCAATATGATTTTGATGCACTCATTCATCTGAACTAAACACGCGTAGGGTGT
CTAATCGCCGCTTCGTGGTATTCCTTCAGCAACGTATAGGAGGAATCCTTAATGGTAGCTGTTCCACTCCTTACAGTCAGTGCTTAGCGATTGTTTTCAA
TGACGGAATCATTAATGGCAATGACCCTACTACTGATATAAATCGTATAACTTCTGTAACGTATTGCAATCTGTTGCACATGTCCCCGAGAGATATTTTT
TCCACCCATATCATGGTTACTCATCGGAGGAAGTGAGGTAGTTTTATGACCCCTAGGTTTATCCCGGCCACTTTGATCCCAAACAAATATTTTTGGCAAA
TTAACTGACCCGTTAAAAGGTGATACTGGCTTAGTTGTACCTTATATCGTAACAAGGATAAACCATCCGTTGTAATTTCAGGGCTTGACATTTTACTTGT
AGCTTGCAGTCACCCTTCAACTCCACCAGGTTTAGCCGGAATTCTATGACAACGAGTCacttttcatcttcattgcTCTGACGCAGGAGACTGTAGCTCA
AGGTCTTTTTACCACCCCGCTGAAGTTGCACTATAGGGTCCATGGCATACGATTGTCCATTCCAAAATATAAGCGATAGACTGTAAATGCCGCTATTTAC
ATTATCTTGTACCGCCTTATCCCAAGACATCGGATCACTGTTGCTTTTGCCATCGAAGCTCCACACGAGGTGCCTGGCGCTGCCATTGCTATTAATTTTG
GACATTTCTACGCTCTCCATGATGGTCTTTGCAGCTTCAAACCAGCAGCAAAAGCtatctgcagcggggttgaCGTAGCGCTTTGATTAGAGGAAGCATA
CTTACGGTCACCCCCCCCCNNNNNNNNNNATTAACGTTTAACAATGCAGTGGAGCACACTGAAATTAGTTCAATAGCAATGGAAGTAGATCAAGCACAAC
TNNNNNNNNNNGCACTATGTGGCTGGTACCAATGATCACAGGACAACTCGATTCTGGCTATGCCACCACGAGTGCCCAACCTTGACTCGAACTTGAATCG
AAGACTTGAACCGAGGCttgaccaacaagtgctaccatgtCACGAAACgcaggcgaggaaacgttggcggaggAAGGCGAACTCGTTGGCGCAAGGTGAG
CGCTGGCGGAGGCTGTTGGAGAGGAGGTCCTGCTGACTTANNNNNNNNNNTACTGTATTCGCATGCTTACGCAAAGTTTCATACGCTGGATTATCCTTGA
GAACTTCCCATCCTTGACTCTTAAAGCGTTCAGCCTTCTCGGAGTCATGAGGGTTAATGACAAAAATTGCTTCAATGTCTTTGTCATGGCGCAACATTCT
CAGAATTTGCTGGGACGAAAGTAGTCTTGTCGTTCCATGTTGCCCCTTATGGCCATGCTGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGCTCACGAAGCCACATCATGCCTAATACAACATCCTTATTCTCCGGGATGGGCATNNNNNNNNNNAAGGCAAAC
ATGTATAATTTGAGGGGATATCTACAGACAAGACTATGTCTATGACATATAAGAGCACAGCAATTTTGCAACCAACTTTAAACAATGTTaaaattacacc
gctgaatacatgtggatgattacggatgctgattacggacataNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCAAATCCTATCCTATCTTTCTAAACCAATGAAAATCTACTTTTCTACACGTAACTTGAATATTCCGG
CTGTCACttgattccttgtcgtaCCGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAAGTCTACTCTTCTTGTTTTTCTTGCTATTCGTGATGTAAAGGCGAATGGAGTAATCGACAGTTCCTTCAAGAATAGTCTGAAT
CTGCTGAATACGTCGATTTAGAAGATCANNNNNNNNNNccatttaaaattaggcggctttgccgcagataaaaattaataaagtcggttttggatttaaa
cggaagagttaattagccttgggttaaggctataattactgtTGGagcaagcggattgcgaaccGCTAAGCtcttacttgttctgagtatggaacgagag
gtcggtgacctaactttcgcttcctcaaagcgcaaagctacggcagccccgctgaaaATATATTACGGGGTAGTAAATCAGCATGATTGTTTATGAGCTC
GATTTTTCCATGAGCCCTGAGCGGATTCAGAATGAGAGTCCGGAAGAGGCCTGAGCATTCAGGGATTGTGTCTGGTGGAAGTGAAGGATGTTGTCCGCAA
CCAGCACGACCAATGTGAAAATGGAGCTGCTCCCGTTGGCCCAACAGCTTGAAGCGATGCGGCCAGTGAAGCGTACCCTCCAGTCGATGATACTCCCTCC
AGCTGGAGAAATCGATTGCATCGATAATCAAAGGACCATGGCGACTGGGTCCAAGTATCGCGTGGCATGGATCGACGACTCGACCCGATATGGCTACCGC
AAAACTGGTTGATCAAAGACAGAAATGTGAATCTTGTCGAGACGCCTGTAGCGTACCTCCTTCGGTACTCAAACCGGAAGCTGCTGTACCAAGCGCTCAC
CGGCAGGAGCGCTATAGCCTTTAGCGCGGTCGCCGACAGGAAGACAATGCGTGCATGACTCATGCGGTCCAGATGGCGCTCGAACTCCTTGACCATTAGC
ATGAGAGTGCACGACTCCCAAATATACAGGCTTATTTACAGCCCTTGGATCAGCTTTTACTTAAACCACCGCATCGACAATAAAAGAAACATTACCGCAA
CATCCAAGCCTTTATATAGTCATTAACCAGTAGTCAATCAGTCTATTGTCGAGTCTTTCAACTGACCGTCACGGAGTCCTATCATCATCATACGTACCTA
TACATCGGAATTAATACATGTCAAAAATAATTCAGACAATGCAGTGTGAACGTCctcgcattttttttattgcgACGGCGGTAATTTGCGGACTATGCAT
TGAGTGGACGGCAATTGCAGTGATGCATGTCACGAGGGCTGGTGACTCGATTCACTTTCAGTAGCACGCCTCTCGGAAGTTTTGATGGAAGTGTGTGCTG
TTTGCTCAGGATGCTTTCCGATAATTTCAGTACAACGAGGTTGCACATGACATTGGGAGGTAGGTTGTTGTGGCCTCCTTTCGTTGAACGAACGCTTTTT
GATTAGCCATTTTATGTCTTATTGGAAGAATGCAGTCCAATCGTGCTGTATACATTCATTCTGAGTGCAACGCTCCAAGACAAAAAGTCCGCATATTTTG
GTGCTTTGATAGTTTGAGC