Description :
Non Conding Region
Location :
Scaffold_1:131317- 131460
Sequence
143 bases(100 bases per row)
TTCTAGAAGCTCGCAATTTGCTTTTGTTCTCCACGTAAGAATATCTGTGGATACATTCGAGACACCTTCGGTCGACTTATTTGTTTTTATCTGTAGTGAT
TCATTACCGATTCTTTCAAGTTGAAGTGCTCGCAATGACGCAA