Description :
Non Conding Region
Location :
contig_1:131221- 137982
Sequence
6761 bases(100 bases per row)
CTAGGTAGAAATTTGACTACAGCACGTGCACATTTAAAACTTTCAATGCATTAGTTGTGCTGTTACTTCCGATGACTATTTGAGGTGCATACTCATGACA
AGATATAACTTCATTTGTGTTTACAAATAAGAAAAACATATCAATTTGCAAAACGCAATGCCACGCCGGGTGGTGAGTCTAGAGCCAAATGCTAAGCCTT
CACCCCTGAGCGCACAGTAGGTTCCCTACGTTTCGCAGAGTTGACTACATGCCCACTACATTGTAGCGGAGGTAATATCAGTCTATGTACTTTGTCTGTA
AAAGTTGTATAAATGTTTGTGCCTGGCCAAGACATCGATCACCACAGATGTCAAAAAGAGGAATGCCAATATTTACCTAATTCCCTCTTCCTAAATCGCC
ATATTTGTGCGGCAAGTCAAGGTCGTAATTATTCGGCCCAGTAAATTACACCTAAGTCGTAATTTATCGTTAGGCACTTTTAGGTACTTTAGGTACTGTT
TTGAGGCAAGACATTTGACGCCCAGATTTCAAATATTTAGTACTAATAGCTCTACTAATTCCATGAATGCCTGAACAGCCTTTGGATCTTTGATGGCCGC
ACGCAATGGGTAGTTCTCCGGCGAACCCCCCCCCCCCCCCCCCCCCATTTCGCTCTCATTCTTCGATTCCCGTCTCATCGATCGCAACAATGAAGTGCGT
CAAGATTGACTGCTGCTTTGAAGACCTGGATGAGGCGTCCTCTTGTTGTATTTGCGGGCGACAGGTGCATCACCTATGGAGCAACGACCTCAGAAATATG
GCAGATCTATCAAAATGGTACGGCTAGCCAGATAAGCCAGATAGGCGAGCTTACTAACTCAATATTTATACAGCTTCTGTAGCCCCACGTGCGTTAGCAC
CTTTTTCGGCAATGCTGACGCTTCACAAGAGCTGACTCCGGGTAGCATCTCTGCGTCTAGTCAGGCTACAGTGATCGACCTTGCTCAATCGGACAAGGTT
GAAACAACCGCTCATCTAGGTAACATCTCAGCGTCGGTCGACCATCACGCTCCGGACAACACGACAGATTCCATCTAAACTGTCGTGCACGTGCTCGATG
AACCCGTCAAGTATCGCCGCAAAATGTTTACGCACATTTGTCTAACCTGTGCGAAGACCAAACTGTCTCTGCCAGATTGCACACGCTTCAAACGCGAAAT
CGCATGTTCTGCAATATCACCCGGAGCACGCGATATCTGTTAAGGAGGTCAGCCATCGGAAGCAGCGGAACCAGCGGTTCATGGTCGAGGAGAGTAGTAA
ACGCCCTGCCCCAGAAAAAGAAGCTGTTGAAGGTAGTCCTGAAGAGAAGCAGCCCGGTAATCCCCAGAAGATCTGGTGACAGTCCAAACCACACCAAGAC
TTTATTTCGGGACACATCACGCGCTGGTTGATTCGAGACGGCAAGTCTGGTGTATTTTATTTTTTATCGGCCTAATAAAACTATTCGTGTCGTTTGTGTA
CTACAGAACTATCCTACAATATGGTGACTACAATGGTCTTTTAAGAACTTGTTGCGGCTTTGACTGGGGGAACCCGATGTTACCATTCTAGCTTCTGAGA
CATACAATTGCATCCTCGACAGTCATTACGAGAAATATCTGGGAGACACACGCGATTTACTACGCAAACAGCACGAACTGCTTCACGAGACGCCCTTCAT
GAACGTGATGCATGATCTTTGGACCCATAAATCAAAGAACTCCATCGTGGGAGCCTCGGGGTCGTTTATCAACCACTTCTGGAAGCCTTGCCACTTGGCC
CTGCTTGCCGTGACTAAGACCGATGGACATGAGTCAGCTCCTGTCGAGGCGTTGATTAGTAGAGAGCTAATGACTCTGTACGGATTTAGTATGGAGACTA
TGGTTCGCTTCACGATTTCTGACACTGTACCTGCATCTCGTAAGACCTCAAATGAATTTGACATTACCCTCCAAACTGACTGTGCCATGCATGCACTGAA
TCGCTGTCTCGGGTACGGCATTATACTTAAGAAGAATGTGCGGACCCAGTATTTGACAGATGTCGCCACCGAATTGACAACCAAGAAGAGGGTCGTGCCT
TCCCAGCAGGTGGAGCGGTGACCCGCAAGTTGCGTGCGCTGAACAATTTCTTTGCATCCAGTAACTCCCCCGAACGTGTTCAGCGCCTTACTGATATTCA
ACGTTTCAAAAATCTACCCCAACTATCAGCACTACTGGACATCGTTCGTGTTGCATCCGCATCCAAACTACTTCGGCAATCGATACTCAACTACGCTGCC
TTTCGCGCCTATTTTCAAAAGGAAAGTGATGCCAAAACCGAGAAAAATAGCTTCGATTGCATTACGAGAGCGGACTGGGATTTAGCTGCTGAGATGGAAG
CGATTGTGCAACGCGTCACCAGTCTGGCAGTCGCAAATTCTCAATCTGCGAGTTTGCTTTCATCGACTATGTACGTGTTTCTTCAGGTAGCGTCTGCACG
CATGAGCTTGTACAATTGTTTTGCATACTGTCTCGATGGAGTCTGCGATGAAGATACAAACGAGAGGAATTTTGCCCGCATTGAGATGAAACTCGAGGAT
ATCTCGGTTCTCGGGCACTGCTGTATCAGACGGACACTCCATCAAATAGCTAACCAGCTACCGATGCCTTCGGTACAGATGGGTATGACGCTACTCCTCG
ATCCACGTACGAAACGGGCAGCTAAAAACTATCTCCGCATCCCCGATACAGCAGAAGCTGTCACTGATAGTATTCTCACCGAAACAAATGAGCTACTGCT
CATGGAGCACCGTGTGTTATGCTGCGCAACATACGGGGACTGCACCCAAGAGAATTGTCCTGGAAACTTAGCATCTTCGTCGTCTAACGAGTATACGGCG
CAATGTGATGCTGATTTAGATTTACTATGCGGAGAGGAAGTAAGTCAACAGAACGCGGTCAACGCCGCGGACGAAGAACTCAAGAAAGAAGCAGATGCAG
AAGTAGAGAGGTGGCTAAACCACCGCGTCGAATGGGTAGAAGTCGGAAAGTACCAGATTGCAGACGAAACCGAGCGCAAAGAAGTTTGGCCCAAGTTGAC
AATGCGCAACAGGGAAAATAAGAGCGTTTGAAATGTAGAGCAGCTCTGTCAACACATCGGCGTTTGCAAATGATTTGCTGAGTCTGGAGAAAAAGCCTCC
CTGCCGATCGCAAAAGTTGTGCGAGTCTGGCTGGGCCGGAGTTCTTCTACGGCATTTCAAGAACGTGTATTTTCAACTGGGTCGTTCGTCATGAGCTCGC
TAAGGACGCGTACAGATAACGAGCGCGCACAATGGCAGCTCGTGCTGCACCATAATCGTGCCGAGATTGAGCGGATGGAGTCAAGCAAGTGCGGTCTGTG
GTGAGCCGATTTTGTCATTGAGTTTAGTACTAGTAGTTTCAATATTTAGTCTTAGTTCTGAGCCATCGCTGCTGCTTTAGTAGTGATAAACTATAATCTA
ACGGAAGCGAGGCGAATATTTAGTCTTAGTACTAAGGGGCCAAAACCACCACCACTACCAATCCCTGTCCACAAGTAGTACGAGTCGTAGTAGTAGCCCA
GGCGCTGGCATTTGCCTACTACCTAAACACTCGTAGCCTAGAATCTGCTCCATTAGGGAGGAGGCCTCCGCTGGCCTTCAAAGCATCTGTATTTAATGTG
CTCTGAACGACCTGCCCTATCATGTGTTCGCAGACGTAGCAGTGCCGTAAAACATATGTCCAAACAGACAAGCAATCTTTGTGACGGACTACATTTCTAT
CCTATCATATTTCATAATTCTTAAAATAGACACTTTTGACTGGTTGTTGATAATGTCCGTAGGTTTACGGTACGTACCGCTGTCCTCGTACGGCGTACAT
GAGCTAACTTACACCAACCTGGCGTGGTATCGTGTTGGTCCATTCATGCGCTCATGCGCTTCATGCTGCTTCACTGCATGTTGCATAATTTGAAATCTCC
ACTTGGTTGTTGGGGCCATGGCACTACATCCCAGACTTGATTTTTGTATCGAATTGGGTTGCAAAACTAGCTGAACCCGGAGTTCGCCAGTATCGGTTGA
AATAGGCCCGTAATGAATGATTATCAACCCTTTACCAAGCAGAGTTCTTGTAGCGGGGCTACGCAGTCGGTTCACCTCGTACCTTAGTGCAACACGCACT
AATGAATATATACAGGCTGACCACTCCACAGAGTGGTCCACATTCATAGCAAAGAGATATGACTGGTAGAAAGCAACATCTTTCTACCAATGAGAGTCAT
TCATTAGATAGGGTTCTGCGAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATT
TGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGATTTAAGTATACTTGTGGATACAAGTAGACTGGATCTAAGGTAAATACTCCTACGCTTCCTCATA
CACGTGCGCACACGTGTAAGCTAAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGCCCGTCCAACGACCGACTAAAACGTTCGTA
TGGAATACGAACGCGGGTTGAGAACGACCTCGGACAGTAACATGTTCGTGGGTAGCCCAACACGTCTGAAACGCATGTTGCGCGTGCAGACTGCCCCACC
TAATCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCGACGGTCATTGGAGAAGCAGCGGTAGCAACGATGTTGTGTACGCTATCACCGACGGAGCAAC
ACGATGTTGTTCTGGGTTTCATCGTGAAGGAGCAGCGTGAAACCACTGCTCGAGCTTCGGTGTCGCCTTCGGCACACCGCGCGTGGAGTCATTGACACTC
CACGTAAGCAGCTATGTTGGAAGAGAGGGGGAACCTCTCTTCCGTTGGCTTGTCGAGGCCGACACTGTCATTACTGCTCGACGTATCGTCGACCTGTTGT
CGAGGGTTGCGTTCGCCATGTCATGTCTTGACGGACGAGCAAGGAGTTGGGCGTACGAACGCCGACTCACAGACCCTACGTGCTTCAGCGCGTACGAGGT
GTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCCGCAGAACGAGTTCCGATCGAGGGCAGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCA
TGCTTACGGACAAAGAGCACGATACTTGGTCTCGAACATCGTGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACGTTCATGAAAGGCCTTAGAGAT
GGGCCTATGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGGGCTCGCAATACAAGAAGAGTTTAGCCTGCGGCAGGCTAAAC
TGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGTAAGGCCGTCGGGAGGACCGGAACCAATTAACCTCTCGGGTGCGACGGCTGCTGGTTCCCA
GCAGCGTCATGGATCAACGAATGTTCATTGTTTCCGCTGCGGACACATCGGTCACTACGCCCGCGAGGGCACAGCACCTGTGCGCGCGACCAGGAGCCGC
GTGGCGATACTGGGTATCGTCACAGGCTAACAAAACACTAGAGGGACCAGCAGGACGCCCGGCGCCCTGCTGGTGATGCGGTCGAGCGTGTCGACATTGG
ACACGCTGTATTGAAGATCGCTGCCCCCCAGTGAGAGTCAATATCACTGCAAGAAGCAATATGACAAGCCGAATCTTGTCATCCTGAAGGTAAGCTCGAA
GAGAGAGAGGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGTCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACA
CCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGTGTACGCTTCTCATATCAAGAGAAGAAGTTCG
ATATGGTATGGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCATGCACTTCGGGAGCAGCACATGCACCACGTA
ATGCATGCGTCCCTCCATCAAAGACAGCGCGGAATGCGGCTGTCTCGAATCACCCCGAGGGAACAACAACGACTGCGAGAGTCGTTGGAAGAAAATATGA
ACCGAATCAGCAGGGCCTGATTCGATCGGATTCGAGAAGGTCTCGAAGCGTCCGGAGTGACGCGGTCGTGTCGACTGATAATGTCGACACACAATTTGTC
GAAAGACACTCCGCCATTAGGCGTCGAGGTAACGAAGACGCGTCGGCTCTGTGAGCCGACGCTACAAGCAGTGCGGACGATTGCAAACGTCCCGCACCGG
AAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGAGGTACGCGATCAAGCCGGGCTTGAACACGTGCGCCCGCGGTAGAACTCGCCAGCAGA
TACAAGGAATATCTACCACGGTCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGTGCAG
GTCCCAATCAGGGACCTAGACGCTACAAGCAGTGTCTGCCGAACAGACACAGGAGTTGGAGACAAGCGTCGAGACCCTGAGTGTCTTGACGCGTACAAGT
ATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTCGA