Description :
Non Conding Region
Location :
Scaffold_1:131155- 133476
Sequence
2321 bases(100 bases per row)
TATAATAAGTTTCGTTTGTACTGAATAGAAACATCAAGTTAAATTTAAATAAGTACTTGTATCTGTATATAATTGTTTACCGCCTTCGCAGCTATTGCGA
ACGTGACGATCATACTGGGCATCTCCAACGGCGTTTTTGAAAGCTAAGCTTAGAAACGACGAACAGGCCAAATCTTTTGCCCTACGTTTTTCTATTTAAC
CTATATGTTTTGGGGCAAAACCTACTTGGGATGAGCGTTAAACAGTAATGTGCCGGATAATGATAGGTTTAACCCACTCCAAACAGTAAATCATTGATAT
AGACTTGATTAAAGTATTGCAAAATGGGCTAGCAAACGATACAAATATCTATTTATACAGTTATTATTCGTTTATAAAGTAATTAATTATCATAGGTTTA
ACGACCTGCAAATACGGTTGAAACACTGTAACATAATTTCTGGAATATTGATATTGATACTGCGCTGTAAAGTTAAAATCACCCAGCGGGCACTTAATGG
CCTCGGCCGCGTATTAACTCACTAAGGGTTTCATTGTTGCGGTCACTCGTTTTATCCAAACATATCAATTCTGACATTCTATTGGGCAGGAAGTTCGGCA
AATCAATGATGCATCGGCAAATCAATGATTGTTTCCGTTAGTACCACTTTTCCGGACAAAGCGAAGGTCGTTGGGTAGGTCATATCGCTGTGGCTTCTTG
TCTTTTTTGTCCTCAATTTCAGTTCAGTTATTAGAGATAGTCGCATCGGAGTAATTTTCTGATTGCAATAGCTTCCCAATGATAGAATGATGTAAATATA
ACTGATTTGTGAACTAACGTTATTATATTTGGCGTTCATCTGCCCCATGAAATGTAAAAGGCGAATATAAGTATAAAATGCAATATAATCTGAAATCAAT
TACTAGTATAAAATTCGAATGTTTAAATAAATTCTTCAAATTTAACTGCAAAGGTACTGTACGACAAATACGGCAGCAACAGTGAAGCTCTTTGTATCAG
GGGATTAGTCGTCGATTCAGGCTAATAAGAATAACTAGCAGTTTAAACACTAGTATACGAACAATCTTGTAAGTTGTATGTCTGGAGATATTTTTATCCA
AGTCATATTGTTGACTAAAGCTCCGAACCGTACACTATATCTACCTAGACCTACAATTGTTGTGTTTATTCTAAACTGGAGCGACATGGAGAATCAATCG
ACGCTAACGTTACCAAATATACGGAATAATCAGCTGAAGTATTTAGCCAATCAGGATATGAACGTCGAATTAGTGTGTGACTTCAACTAGTGTGATACTA
ATCCCCATAGGTTATGTTTTTACATAGATAGTAATAATAATAATATGCTAGTATTTTAAAGGTATTGTGGGCCAACTCTGTGGATATTGAAGCCTCACTT
GAACTCAACCAGAAATGCTATAATTGTACAACGATCAATATATGCTTCGAAGTACTAGAATTTCATTCTAAAGTCATGATTTCCGTTTTGTGCCTTCCAA
GTAATTGGATATTTTTAGAAAATGAAAAAATTGCTCCAAGTAGAGTTTCCTACTTTTTTACCCCTTTTTCTTCGATCTTTTACCAAACTCACTATACCAA
AAGTAGAAAAAGAGAACGTATTTTTCCAAATCGCGAAAAAACAAAGAGGTAAATCGATTTTGATTGGCTCATGCTCCTTCTAAAAACTAACCTTACTTGG
ACATACCAGTATTAACGTTAGTAGTTAAGCAAACCACCGATTTGTTGAGACTGGTCTCAACATCTGCGAAGCTAATTGTACAACTATTAATATGAATATA
TACCAGTACTATTAATAGTATTGAATTCTAGAGTTATGATGTCCGTTTGTGTCTTCGCAAACCACCGACTGGTCTCAACATCTGTGAAGGAGTTAATAAA
AATAATTCGAAGTAATAGTTACTTCAAGTACCTCGAAGTACTTCGTATAAACAGTAAACAAAAAATGTCACAGAGGCGAATTTTCGCAAATTGACATGGT
GAAAAGGCCTCCAATAACAATTTTGGGCGCACTATATGTGTACGTAGTAATAATGACAAAAAGATATTATTGCTCCATGAGTAGCAAGGAGATGCAGGAA
CTGGACTCATCATGACACGAAGTTATGTACGCTTAAGGCCAAATCGAGGCCATCATGGTTGTGAATGTGTGCAATTGATAGTCATCATTTCGCCTGAACA
GTTGGTATGATGCTGATAGTCAAATTCCGAGCTCTGAACACTGTAACGTTAATGAAATAAAGCTGATAACCGGATAATGATCAGTTTTCCGGAAGGCGCT
TCTGCATCACTTTTGAATTTC