Description :
Non Conding Region
Location :
Scaffold_1:131087- 131256
Sequence
169 bases(100 bases per row)
ACAGCAGCACACGATCACTGGAGTGGTATGGTACACGCGCTAGACGTTTATTAGCGGCTCATTTGTGAGAAAGCAGCACCTTTCCCTACGCAATTTCCTA
TTTGAACGCGTCatgcagcgtcttcagcacttCCACACGGACTCCTGAACACTTGTTTGGTAGATTGAC