Description :
Non Conding Region
Location :
Scaffold_1:131087- 131229
Sequence
142 bases(100 bases per row)
GCTAGACGGACTGAAGTTCTCGTAAACTTAGGTGGATCTACAAATGCAACGTGCTAGAGATTGATAGACAAAAGCAGTCGAGCAAACGTTTAGGTCGGGG
TCGAGTGTAAATAACGACTAAATAAACGTATTACGCGTCACC