Description :
Non Conding Region
Location :
Scaffold_1:131023- 133311
Sequence
2288 bases(100 bases per row)
TGGCCCCAAGTAATGTGAAGCTGCTCGATCTTATTAATACTTCAAACAGCGTCGTATCTTTTGGGTGGTTTAAGGTGGACCACCTCAAAATGGGTCCAAA
GAGTTCCAGTACTGGAACTAGAACTGGAATTCTAGCCACTCCAAGTCTCCAAAGCATGCGACTTGCGTGGAGAGTGCCTTAACTGTACCGCGAACGTCGT
GACTGCACCCAAAGAATCCCGTCTGATGGGGGTTTGTGCGCTCTTGTCGACTCTGCTTCCTTGCTACTACGAGCAGGTAAGCATGAATGGATTGATTTTA
TGCGTCGTAGACATCTCAGCGTACTTCCATCTATTCATCACGAAAATCACGCTGATTTACGAAAGATTCCAAACTGCGGAGGCGGCAAGGCAGTCGAGAG
GAAATGACGTCTACGTGCATCTTTTCATACTCACAAAATTCTCTTTCACCTCGTGTCATTGACTCGCTAGTGCTCGTACTCGCACTCGGCACTACCTTCC
TTCCACCTATGCACACACACCTACAGCATCAAAGCTTCTCCCTCACCCTGATACTCGCGCATACAGCTTGTCATCTTCTTCACTTACTCCGCTGCTCTTC
CCACCACTTTCGTTTCTACTAGTGCATGACCAACGCGATGAAAGTCGCCTTTTGGCGGACGGTCTGCACCATGAAGCTGAAAGGGCAACCTCGCACCCCA
AGATGGGCTTAAACCTGTGAAACTTGATCACTCAGTTTTTTCTGCTTGGTGTCGAATGCGCATTCACCATCAACACGGCGGTTTCCTGTGCAAATTCGGA
CGAGTTGTCAATCAAAGAGCCACGTCGCCAATGTCCGTGCCGTATGAGTGAGCACGAGTTTCGCAATCGTTTTACGTATCAATCATGAGCGATGCGGTGA
AAATGCGGTTGGCAAGCAGCAGTCAGCTCATACCATTTCAGCTACAGGGTAGAAGCGCATGTGGCTTGTGATGGGAGCGTCCTATGTTATCGACGCCGCA
GCAGAAGATGAAATAGGACGATCGAAAGGTTTGTTGCAAGGTGCACAGTGGACGCGCTCATGCGGATGCTGCTCATGTGGAAGCTGAGTGCACGAACAGA
TCGCTGCGGGCTCCTCTCCTCCACTCTTCCAATCCTGTTCTGGCGTCAGGCCCAAACGGCGCACGGGTCTGTAAACCACCCGTTTTTTTTCACGCTCAGG
AAAAGGGAGAGTTTCCGACATCTTGGGTGGCGGCGACCGACTAATCACGGAAAACGCATTCTCGTGCGGTGTACTGGATCTGCTACCATAGGTAAACCAA
AATCTTTATATATAATATCAAATCAAGATCTCTTCAGTTGATCTTACAAGCTTATCAGCGTATTTGTCAGCATATTTATCGAATTTTGAAAATATTTAAG
AGCTATCTTGAAACGCAAGTTTGAGCTCTTGGGCTTTGCGGATCTTCTGTGACTCGTCGACCATCACTCCTGTCTCGCGTTTGTACAAACTCTAGCGCTC
CCATCTCGCTAACCAAACCTCTATTACTGGATACTACTTTCTAAAGTGATATACCGATGTGGCAGTGTAAAGCATTTTCTTCTGGTGCTTGGGGTACGTG
TTGCAGAAGGTCCTGTCGAATATTGTAGCTCTAATGAGCCAAACATATATGCTTAACAGGATAGTTATGTATGGGTATGCTTCGTTTATGGTATAAATGG
ACCTGCAAAACCTACCATCGCGTCTGCCTCGTTGAGAATGCATTGTTTTCGGCTCGATGTGAGCCGCATGACAGTGGGTTCTCCGGTTTCCGATGGTGCA
CCCATCCCCGCATCGGTTTTTAAACCAACAACCTCTATAATCCTATCATCTATGCGTGCATAGGCGGTCCATCCTCAATCTCAGCTGCCAGATGTCCCGC
AATTCATCAGCGCATGAATTGACAATGAATTGAAAATGAATTGCGATTTCTAATTTGAATTGCACGATTCATCTGAAGTTTCGAACCTGCGGAAATGCGC
ACGCCCGCATTCACTCACTTTCCAACTTGACCCGACGGCGGCACATCGACCCCCTCGCCCCCGCCCCCGCCCACGCCAAGAAAAAGAAGAAGGAGCCGCG
CCCCGCATCATTGTCTGGTGTGTGCGCGTTCGTTCCTTAGACCACCACTTGCGTTAGCTGCTTCCTCCACTTACCGTGCGTCTCGTGCGTCGTTGAAGCT
CGCGTTGGTGCTGTTGTTGAAGATACAACTCTACTCGTTATAGTTGCTTCAAAGAGAGAGAAAAAAGATCCGTTTTAGTAATTGATCA