Description :
Non Conding Region
Location :
scaffold_1:130696- 131402
Sequence
706 bases(100 bases per row)
TAGATCGACGTTTCTGTCTCAGAGCTCTTCAATGTGAAGGAGTGCCCCGATCGCTTGACAGGAATCTCTCCATTCTGTTTTGGTGCAATCCACACCAGCT
CTGGCTCGCATCCATACCCGATCGGCTGTCAGAAAGTGAACAGTGAAGCACTCTTTCAATAACCTGTCTAGCGTAGCAGAGGGTACAATAAACGACTCAC
CATTTCGGTTTTGCCCTTAGTGGGATATACCTAGGCTAGCTTGCCTCTCGAAAAATATCCTTTCCTGTTGTCGAGCTTCGTCCTTTATCCGCTTAACGCT
GTCGCTCCTTGGCCTCTCGTACTTCCGAGGTATCGGTTGGCTTCACACTGCCTGTGAAGTTCACAGGCATTCAAGAGTCGCGACGTCGCGACCAGTTGCG
CAGATCCAAGATATTGCTGTCCCTTCATCGATCCGTTATTGCGAGCCCTGCCCGGCAAAACACAAACATCAAACCGCACTTCCCACGGCCAGCATTAACC
TGCTCGATACACCAGTAGACCTCTGTGCTCAAAGCGCATGCTTTATTTCATTGCGGGCTGCTCAGCAACCACGCCCTTCAATCTGCACGCTCTAGACGCG
TAGACATCACCTGCAACTGGCACTCAAAACCACATACCACCCTTGGACAGAGCAGTGACCAAGTCACCACGTTGCTAGACTCAACACCACAGGCAGTTAA
TCCACC