Description :
Non Conding Region
Location :
scaffold_1:130379- 131498
Sequence
1119 bases(100 bases per row)
GAAGATCTATAGGAAGAGTCCATCAGCCTACCGCCCAAGTTTGACAGGGATATCTTTCTGTAAGAATGAAGTCTGTTGCCTGTTCCTTTGTTGCTGTTGG
AGGTACGACCAAGTGGGGGGGCTATTGAGGACTAACGCTGATCCGTATATCCATTGGGACTCCCAATTTGGTAGCTGTAAGGAAGAGCAGCGCTTATATA
CGTAGAGCGTTTGTGCGGAGTATGTACGGCTGACCAACACGATACCGAAGACTGGTGAAGTGACGTCTCCCGGCAGTTTCTCACGTGGTATTTTGTCTGA
CGTTGCGATATCAAAAGCGTCCAGTATGTCGACTCTGCAGAGAGATCCGCGCCGCCCCAGCGACTTGCACCCGTTTGTTCGCGAGCAGGTGGAGGTCCCA
GAAGACTGATACAGCTTCTTCTCACTCGTGCTGGGCTTCCTCGCTTTCATCATGAAGGTACGCCACACGCATTTAGAACCACGTTTCCTACTCCTAATAA
CTCGTGCTGTAAAAATCACAGTGGAGGGAGCTGGCGTAGGGCTCACTGCTTCTGTGCATGAGCTTGTTCACCAACATGAAGCCGCAGGACGTGAATAAGA
CGCACTTGGCCTTGTCATTATTTTTCGTCACTTCTACCCTCGTGTCTGCGTTTCCCACTCCGTGCACGACATACACGCCGGATGATCACTTTTGGCACCT
GTTATTAACGTTGTGGTAGCCTTTCGCTTCGATGGCAGGATAACTCTATTCAGGAGGTGACAGGGAGATCTATCATCTGTAAGAAATGGAGTCTGTTGTT
CTCGGTGGTAACGACCAAGTGGGGGTTATTTATTTATGACTAACGTTATTCATTCCGTGGACTATGACAATTAGCCCTCAAGCATACCCAGAAGCAGCAC
GTACCAAGGAGCTGCTGCGTGAAGATGGATACCAGAATACCAGTCATGCTACTGCTAGCGGGTTACCTCAGAAGTTGATGAAGCGGCCGCGGGGCCCCCC
ACCAGCTAAGGGGCTTGCAACATCGACGACCCAGATCTTGCCACCAATTAGGCCCCCAAGACCAAATTCACCTGTTTCGACTTCGAACATGACACTGGAA
GAGAAGCAACAACGGCAGA