Description :
Non Conding Region
Location :
scaffold_1:13034- 13735
Sequence
701 bases(100 bases per row)
GTGTATAAGCTCGAGAGGGGGAGAGGAAGAGGAAGATAAACTGCTGCTGACGTCTGGCTTCTTCGCGGTTTCTTGGGCGAATGAGGGAGTCGAGCTGCCA
CGAAGCCGACGCCAGAACGCATACCTGTTGAACAAGATGGATGGAAAGGAGCCATTACCTGTGAAAATACATGAGGATAGTGGGAGAGCTGGAATATCAA
CGTATGAGCGCAGTCGACGTAGTAAACAGCCAATCATAGCGTGTTTACATGCGATCTGACGACCGTATTGGACACAAATAGGACGAATCAGGTCGCGACA
CCTTGCAGCTATTTGTGTTGTACACACGACAAATGTGGGCCACACAAAACCTTTCATTTCCGTTCTCTAAGGGACAACGATAAAACGAAGAAGGCAGCAG
ACCGCGGAGTTGAAGCTGTCGTATCCGCGCTTAAACGGCCTTGCCCCTCACACCAGGCACGAGATCAAGTCTCCAGGACACAGAAGTACCAGAGTCTTAA
CCACTTGAACGACTGATCCAGAGATCGACCGAGCAGGATAAGTGTAACGCAATCCCCGCCGCCCATAAGTAAGCTACAATTATAACAATATTTGTAGACC
CTCAGCATCATCAAGTGTCTGATCGGGTCTGGTGTTCTATTGTTGTCAGTCTCTGCTAAGAACTGTGCAGTCGTGAAAATCCGAGTTAAGCCTGGAAGAG
A