Description :
Non Conding Region
Location :
Scaffold_1:130228- 133216
Sequence
2988 bases(100 bases per row)
aaagacgataagtcatacatttgctggtgcccggggacactcggcataccaccgtaccgcagtggcaccctaggttgctgaggcgctgaaccgtgcccgc
ttcgtgtcaaggacggtcgcaatcctggttgagccgttctaggttgcgcaggagcggcccggggttgcggtggaaccgttcccatccagggaggaaccgt
tcccggccgaggcgcattcgccgcagattgagacacaaccgttccttgtgcaggtggcgcggcggagggagggtttggagccatagcaggactcctagct
gcgaaccgaccagtagttgctccaaccgttccaacacccgtcctcatctggggaggtccgagggggtgaggcggcgcgggcatcctcggcttccccgcga
gctgcaccctctgagtgttcttcactccagtaggggacggaacggtcaccatttgcacttgcatggcaccgcgggacggatcccagcctcatccggtcga
cggacggtccgaccgtcgcttttccgctcccgtgtacagcggaatgaaaccactcgacgtcggcgccggcggcttgacctcttcttcatctgcatcccca
tagtagcccgacaggtagtacctcccgtactcatcaatgtcgtactcgcgtccctcctccgggtcggtcacatactctccctggaacgcttcctcttcgg
catactggcccatctcctcgtggtcgccagtagcgcctccttctcctccactaatcatccactcttcctgagccctcggctcgggctttacttcttcctt
cacgtcatcctgagcgggtgggtgttcgaaaccctccgtcccaccgtcgtcccccgccgcctccaggtctcctctcaatgcgtggcggatcgacaaccgt
cccgccgccgttctcactcccgtagacgggtcggcagctccctcttcctcgtcggtcgacgacatcgacaactccccttgccgagccggaccggttccgg
tgtttccaaggccagcgtccgtaccgcccaaccgttccatacccaattcacttacttgttcttctccagttaccgtcatcttcacacttctcgttttact
tctcctcgatacactcacggtctttctcgtaaccgttctacaaacactccagcgctctctgcgcgaaaaacttctcttcttcgtccgcctgggctcgata
ccagacgtcggcgcttccgggttcaactcgtcacgagtactccgacttgccctctttacaacgaaaaccgtaccctgcttctccaccaggtgtcgcgagt
cgccgcttggacgggacggttaacgttgatgttttgaaagagaacggaacggaggaacacttcgaaagcttagacacaagttaaaatgcaagcaaagcaa
atatacttgtggggtccaaggcaaattcacgactaaactcctaaccaaccttcctcttcagtgtcgtccttcgtccttcgtcctctttcgtcctcctttt
gtccttctcgatcccgctctttccagcccaggtacctcacaccccctctgtgagcatacccaccgtcccgtagcactgagccacacgctgcatcacgact
cccgtcctcgtcatctcctttgacgcaatcctgcgcaggtgcgtgagcgctggcgccacgcgcagacctcagcggcgccctccatgacggcggtccttgg
cgcgacttcccgagtgggcgactgttgggttgtccaacgcgtcttcgtacagctgatcctctctaacttgataactggtagaacggttgtcgggaacggt
acggtcgtaaccgtacccaagacggtgtccattattttcactcgtgacagtatccctaccgaccaccacttccgccccctcctccacggtattcaacccc
ggcaaaacagaattttggatacaccacttgccctgaaattggcatttgcgactgcgccatctgcaccactgacggaagaacagtggagcactacagctcc
atccagtcgttgacgagttgacccgctaaacgttactgaacgtttcagtaagttggcggaatcagaattaatcgtctgagaccgagaattagtcgatttt
gatttgcgcgtcgtccatcgttggactcaacttggagctcttcacaactgcactctacggctggaagaagaagaacttgctctgatgtataaccagcacc
cgcccaccggtcaacctccccagcagcaacaaggctaccctccacaaggagcgcctcagcagcagcctgcaccaggttaccctcctcagcagcagcctcc
cgttgcgcaaccagcctaccctccgcaagcagcaccagcccaagcgccttacccgcctccacagcagcatccttaccctccagctcctgctcctggttac
gcctatccggcccctgccccacacgcgtaccctcagccagcaccgtacgctgcgcctcctcctcctccagtctatgccgctccgcctccagtgtatgcag
ccccgccaccgcaaccggtttacgtcgtgcaaccgggcgtgcaccatgtgcaccatgcacaccaccacggctatggtcaccactacaagtacaagggata
caagcgcaggggacttggcgggatgttgggctttggacgacaccatggatatggacatggctatggatacggacatggtcactacggccacgggtacggc
cacggataccgtcactacaagcacaagggctacaagcacaagtagatgtgaatctgatcccatcatcacttaatcaaacagtcatgacaccacgaagcag
gcaattccctcctatcaatttgattccctctatcgatgcatgcactgtgcacttgccttgcagaaccgaagggcgttagacacttggcatttcctatctt
attgctcgaaactcctgtatttcatctgtgacgtgtgcacactagatatttgtatccagtttcgaacttcattcccgtgctgcaatta