Description :
Non Conding Region
Location :
Scaffold_1:130223- 130627
Sequence
404 bases(100 bases per row)
AATGAATAGTCAGTCGAGTAAGAAGACGCAACGCGAAGCAGAAGCACGCAGTCTCTCTTTTATAGTTATTAGACGAGGAACAACCTTTTTTGTTACAAAA
GACACTTTTATTGTTGTTGGATGCTACAGCTCGTCTCTTGTTGTCGTAGCTACCGAATCAAGTGGTGCTGTGGGCTTCCTTCCATTGCTGCCATTGTCAC
CCCTACTAGGACACGCATGTGGCAACGTCTTGAAGCATGTCTTCCCTTGGTACTTTGGTTCCGAGAGCACGCGAAAGGTGGCAAAGTGGAAGCGAATCTT
TGCGTTTTTGTAAAACAAGAACTCGTTATCATGACCGCTACCATTTGGCTGTTTGAGGTGCGCGATTAGAGCAGACGCAGCAATCTGCGTGGGGCACCTC
GCTT