Description :
Non Conding Region
Location :
Scaffold_1:129900- 130478
Sequence
578 bases(100 bases per row)
GATTTGCTCTTGAGCCGGCAAATTCGAAAGTGAGGATGGTATCCGCACTTGACGCGACCTTCACTCCGATCGAGTTCAACATCTATTCGACCAGCACGAT
TTGGAACAGGGAATGGCTATTAAAATGGATACATTCACTTAATGTATTTTATCGTAGTGGTTGATTAGCCAAGTTGAAGTGGGCGACAGGGGCAACTTTG
AGTCAGGTGCAGCTGGTGAAAGGCAACTTCTGCATGTGTCATTGTGTATTCTAAACCTGGCCTTCGAGGTTGTCATTGCACGCGTGTGAACAGCTCCTTC
TCTCATCGATTCTTGTATTAATACTTGCGACTCCAAGAGAGTCAGTCAATGCTTGTAGCTTGACACTCTCGCATAAATAGCAGAGCCGCCCGCTATTTAT
GCGCTCAGTCGTTGAGGCACCGCGAAACCCCTTCCTCTGCATCTCATGATGGTCCGCCCGCTATTCACGGCCGTCGGCCGTTAGTGTGCACAACTCCTGC
CTCCACTTTGCCCAGTTCCATCAGCACTCGGCACTCTCTCGAACCTCCTCCTTTTCTCTGGTAGTGGCTGGAGCTCCA