Description :
Non Conding Region
Location :
Scaffold_1:129894- 130416
Sequence
522 bases(100 bases per row)
AACCGTCGCTTTCGCGCCTGGCAGCGCCACTGCTTAGCAGAGCTCGACGCTCAGCATATGGCTGGCATCGCATGGCGGTGGGGAAGCACCGACTTGGTGC
CACCGAGTCCACGTCAACGCGAACGGCACCGCATGGGCGGCCGCGCCCGACTAGCCATACGTGCTCGGTGACATTTGCGCCCGTTGTTGTCTCGACGATA
ACGACTGTGAGGGGGGGAGGCTCGCCACGAACACAGCTGCAGTCACCATGGTGACCAACTCAGCAACTCTCAGTATTGATGGCAGTGTATAATACCAAGT
GCATTACTCGCCTCGGTCGACTTTGGTATTTCAGACTCAACTACAACTGTACATGTATATTCCAGGGCAACTCATGAATACTCCAGGGCAACTTCAACTT
CAGCCCCCACAGCAATAATCTGAGGGCATATTTTTTTTATCTTTTCTCGCATGCCACGGGATTCCGATCGTGCACCGGGCAAGAACACTCACCGCTTTCT
CCATGCTTGTGGCGTGTGGAAT