Description :
Non Conding Region
Location :
scaffold_1:129851- 129959
Sequence
108 bases(100 bases per row)
ATCGGACTACGTGGCAGGTTTTGGCTTTGAATACAAACGCCATACAAAACTCTATACATTTTTCGATTCCCTCGACTTTTGCGATAGAGACAAGTGCATC
AACCAGAA