Description :
Non Conding Region
Location :
Scaffold_1:129828- 130959
Sequence
1131 bases(100 bases per row)
GCTGCTGTGCTGTGTTGATGTGTGTTGTGTAGCGGTGGGATGGGGTGGTCTCAGGCTCTCAGCGTGCGCAGCAGGTCGATGCAGACGGACGATGCGTGTA
TGTAATAGAGAGAGGAGCGTCTATGGAGCGAGAGCGTGCCTGGTCTGCTTGCGCGCAACAATGTGTTGCTGCCGTTTCGATACACCGCTTCCTTTCGTTC
CCAGTTTGTCTGGCGCTGTTCGGCCTATCGTAATTGACTGGGCTCGTGGCTTCCAGTCGATTGGCTGAGCGAATAGATTGGCTTGCGAAGTGAATGTTTT
TACTCCATAATGTTTACTCCAATTGGGTTTTAGTGGAAACGTTTTTACTCCGTAACGTTTTACTCCAATTGGCTATTGTTCTGTAATAAAAATCATACAA
ACCTCTATACTATTCACTTTCGTCACTATGGACGGCACTTTGGCACAGATTCGTGAAAACCCCACTTTGTGCCAAAATACATTTCGGCAGTGAAGAAAAT
GGATAGTATAGAGGTTTGTATACTTTGGTGGCCGCGTACATTTTGGCACAGATTTAATTGGGCTCCTCGATAGCGAATATTACGAAGTTATTGCACAAAA
ACAGGAAGGCAAATGAACCTTTTGGAGTCCCTACATTATGAGCGCTTCAACGTAGAAGCTCATCACGAAGTCCTTCTCTCGCATGCTTATCTATCTTTCT
CCTCCTCTTCATGCTTCTCCCGTCGTCCGCCGCATGTCACTTCAAAGCTGTAAGCACAAAGACAACAACATGGTGAACAGAGCGAGAGCAAGAGCCAAGC
GCGCTGACTGCATCTACAGCAGCCACTACAGCCACGGACGAGGAGAGCCCTGAGGCCGTCCTGAACGACCAACGCGCGAGAATGGCTGGGCGGAAGAAGC
GACTGTTTTAGCAAAGCAATCCAATTTGGCAGACGGCGAGACGTTAGAGTTGAGGATGGAACAATCTGAATGACTTTGAGACCAACCTTCCCAACTCCAG
TCCAGGTCTCCAGCCTTCCCAACGGTTGAATGTTTGTCATGAGTTGTCATTTAGACAGGCAAAATCCCTCCTCGCTAAGCAGCTGGGTGTGTATTATGTT
ATGAAATGCAACAAATGGCCGCTCACTCGTT