Description :
Non Conding Region
Location :
contig_1:129706- 130749
Sequence
1043 bases(100 bases per row)
GGGAATGAGCACGTGTTCTCCCGAAGAAAATACGGATTGACGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGCGGGGCTACACATTC
GATTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAATGCATATGACTGGTAGA
AAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGA
AACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTCAGTATACTTGCGGATACAAGTATACTGAA
CTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACATTACACGGAGGCTGT
AACCCTGGTCAAGAGACGCCACGGGAGGTGATATTTTTCGCGCGATAGAAGAAGACAGGGTGCGTACTGTTTCGGCAACGGACCAGCGAAACTTTCTCCA
GTTCAACATGACTTACACGATTCACCAGCAGTACCGGCGAATGCTCGGCTTCGCTCATCCAGACCTCATGCGGTTAATGAAGTACGAAGGTGTCACCCTC
TTCGTCGACGGAACTTTCAAGGTGACCCCAAGGCCGTTTAAGCAGACGCTCATCGTAATGATATACGATTGATCATATGACCTCTACATTCCGGTGTTCT
ACGTACTGCTGGATGCTAAAGATGACTGGAGTTACTACCATGTTTTCCAGTGGATCCAAGTCCAATGCAACCAGCAATGGGCGCCGTCGGCTGTTCTGTG
TAACTTCGAAGCGGCACTCCAGCAGGGCGTTCGGGGCTATTTTCCGTCCGCATTCATTGTTGGATGCCTGTTCCACTGGGAGCAGGCACTGCGACGTAAA
ACGATTTCGCTTGGGATCCCTGCTGATCAGATTAGCCTCGCAA