Description :
Non Conding Region
Location :
Scaffold_1:129618- 130106
Sequence
488 bases(100 bases per row)
TTGGAGGAGGCACGCACACAGCACAGCCACGCGTCACCGCGACTGCCGAAGGATAGGCATGGCATGCGCGGCCGCGACGGCGCGTGGACGTACCGACAGA
CAACGACCGATGAAGATGTAGATGTGAGTCCAAGCAAAGCCAGAAGAaCGAAAAACAAAAAACCAAATATAAAAAGCAAGAAACGCGAAGCCTGAAGATG
AAGATCGGAGTAGACGCGAGTGTTAGACGCTGCACAGCAGCACAAGTGCGGCGGCGTGACGTGTACGCGGAACCAGTCCAaGGGCCGAGCGGTGTGGTCC
CAGCCGTGACGTGAAATTCCCTTTCTTTCTCGCTTtAATTTTATTCTCCCCCcTTCCACTGTAGCGTGTCATGGTCTCTGCTCcccTTGTGTATCCATCC
CTGGTTGCTAAGTATACTCGTTCGCGTATTTCCAGCCTCGTGCTCTGCACGTGAGTGCTCCGACTAATGCACTGAGGCCGGTCGACGA