Description :
Non Conding Region
Location :
Scaffold_1:129272- 129895
Sequence
623 bases(100 bases per row)
ACCAGGAAAGGACATGCCTGGCTCCCCACACCTCATGGGCACTGTGACGTGAGTCCTACCGAACACGGACCGGACCCGCGGTTGAATTTGCCTGCGATGA
GTGCATCCAGGATACACCTCGGTGCCATGGCTGACAGATCGCGGGCATCTTGGCTGGGCAACTTGGTCGCTTGCTCAGATGGGTGCGAATAGCCAGAGAC
GTGGCGGCCAACCATTGCGCACCCACTCGCATCGGACCTGACGAAAGCAGCGCGCCAGCGCTCGCGATGACAAAGCCTACTTGAGATAGATAGATCACTC
GTCGCATAGGTGCATCCATCGCGTGCAAACGCGACGACCGATCCCACTCGGTGGACTAAAAACACGCCTCTTTAGCCGTCGCCTGCGCGGCGCCAACACG
CGCGCAAGGTCATCGCACGTGCCCCACCTTTGCTTCAACTCGTATATCTTTTGTCCCACGTACTGTCGCGGAGTGTCTGCGGCCTGTCGTCGCCTCAGGC
TCGACGCCGCCATGTAGTGTCTTTGCAACGAATGGCTTCCGGCGGGCGGGGCATAGCATTACAAGCTCGTGTCCTCGGGCGCTTCGGTGACGTGCGACGA
TGCGGATTTCTGCGTTGGCCCAC