Description :
Non Conding Region
Location :
Scaffold_1:129044- 129179
Sequence
135 bases(100 bases per row)
ATCTGAAATGCATCGAACTATTATGTTTTAAAGGAAAGCAAGTTTAAAAGTATAATCTCATACAGGTTGACCAGTTGAAGCAGCCGTTGTGGCGCACTTT
CGCAGGACAGCATGCCAGAACCCCCTGCTTGCTCA