Description :
Non Conding Region
Location :
Scaffold_1:128962- 150000
Sequence
21038 bases(100 bases per row)
TTGAGGATCTAGATGCTCGGAACTGAAGGTAGGCGCTGTTGTAACGGATAATGCTGGGCAATGCGCTCGTGCTCGCCGGATTCTGGAGCTCCGGTACCCA
AATATCGCGCTCGTCTACTGTTTCGCTCATGACATCAATAACCTAGTGAAAGCCGTCTTCAAAACGGTGTTCAAAGAGGTTTCGACGGATGCCGCGGGTG
CTGCCAGTTATCTAAACACTTCTACTTCTAAATGGTTGTTGCGAGCTTTCAAGGCAATGACTAAACGCTACGGAACTAGCTTTGCAATTTTCACGCTATG
TGAAACTAGATGGAATTCGATGCAAGCCTGTTTTGCGTCGCTTCTGCGAGCACGAGGGGCTTTGGAAGATATGGTCTTTTCTTATCGGAGACGCAGTGAT
CTTCCGGATTCGCTTCGCGTTTTTGGAGACGTTGAGTTCTGGACAAAACTGGAGACTGCTGAAAAAATCGTCCGCCCATTGTGTGCTGCTTCGTTTCGCC
TACAAAGGGATGAGAATACAGTGGTCGATGTCGTTTTTACTTTTATGGAGATTTACCGTGGTTTTGCGTCAACTGAAATGAACGATGCTTTAACCGATCT
AGTGGAAACTCGCTGGAACGCATGTGAGCAGCCTTTGTTTGTCCTAGGATTTTTCCTCCATCCTGAATACGTGGCCCAAGCGCGGAAGCTTCCTTCAACT
GTGCTCACTGACATCGATGATGTGTGCCAATTCGCACAGTATTATTATCGCCGCTTTGTAAGTGATGACGATGCCGGGGTGCGTGGTGAAATGTTTAATT
GGATACTGGCGATTTTTCATCTTCACGTTTCATCGACTTCCCCACCGAGGATCAAGTGATGCAGTTTTGGAGGTATGAAAAATGTACGAAGAAAGAGTGC
AAACTTCCTTCGCTTGCAATTACAATCCTTTCTATTGCTGTTAATACCGCAACATGTGAGCGCTTATTTAGTGAACTTGCGCTCATTCTAACGCCGAAAC
GGAACCGCATGTCGATCGACAAGACCGCGAAACATCAGATTACTCGTCAGTACGTTCGAGAAAAGAATCGCCTCGAGAAAGTGATGCCAACGAGTTCAAG
AAAACTATTGAGAACGGTGGACCCAAAAGAACGACCATGCATCGCTACGTCGCAAAATTCAGCTCACACTACCCCAGTCTGTGCTACCCCAGTCTGTGCT
ACTCCAGCCCGTGCTACTCCAGCCCGTGCTACTCCAGCCCGTGCTACTCCATCCCGTGCTACTCCACCTCGCCCAACCCAGGCTACTTCTTCTCACACAA
CCCCAGCACGACCTACTCCGTCACGTACAACGCCAGCTCGAACTACTCCCCCCCCGTACATGTTCTACTTCTGCCAATCCGCAAACGTCACTAGAGCAAG
ACCCAGCCCGTGAATCTCAGAGCTTGCCTGGCCAGCATGAACATGACCAATTGCAGTCGCCACGATTGGCACGGGCCTTATTTTCAGGACAGCAAAACGG
TTCAACGGGTGGTATGGACCGAAGGGAACGCGATACGCCATCGTGTCAAACGCCGGCTCCAACTGCACCTGCTTCACAAACGGACCTTGATGATACTGCG
GTGGGTTTTCTGACCGCTGAACTCGATACGGTTGCTCTTAGCGACAGACAATTAGATGAATACTTGGAGCACTTCGACTGGGAGGAAATTGGGGAGTATG
GGGACGAAGACACAGTTGGGATATGGAGCACTATATTTGAAACTCCAAGGCTGAGCAATACAGATTCTATCGGCACTGCAGAAGGCGAAAATGAGAGCAA
TTCAATTTCCAATGAAAGAAACGGCGTTGACGAGAACTGTACGAATGCAGGTGGAGAGGACGCAACGAGCAATGAACGCAGCAGTCCATGTAATGATTTA
CCGTTTACAACGACACGGCTTGGCTCTCATAAAGATACGATTCCACCGCCAAACCGGCAACCTTATCCTCCGTACAATAACTTGGACTTTCCCCAGCAAC
AAAGGTTGACAGGAATTCGAGCGCGAAAAACAAGGCTAGCATCGCTGGTTACGAATTCTTCTGACGGCGAAGCGCAGCTGTAAATTCGAAGCAATAAAGT
ACGCGTTAGTTTCCTCTCAAATGTAGTGACAAGGAGCATTTGTGCATCCGTAGATAATATACTTGATGTTGATGAATTGCAATATACCGTCGCATTTAAT
TCTCATCGAACGCGCAGATTCTTGTCGGTCAGTAATTGTTGACGGCTTCAGTTTTGAAATTCTCAGCGCAAGCCCAGCATTTGTCAGCGTCCGCGAGCTA
TGTTATACTTGGTCGTTCAAATTGCTACAAAAGCTGGGGAAAAGCGGTTGAGATCGCGGTACAGTAGATCCATAAGACACAAGGAGAACACCGTGGCTTG
AGCAGTGGAAAACAGTAGTTCAAACTTCCACACGAGCTAACGAAACACTTTTTGAAAGTTAGTAGTTCAAATCGGATCAAGAGTGAAAATACTACAGTAC
CAATCCACTAGGTTGTACTCACTGCAATGCACGCAATAGCAATAAAGGTCCATCGTAGCAACAACAGACAGCTTGTACTGAAGGAGCAATATACCACTTG
ATAAGGATTTCTGTTGTGAACTCGCCAGCGCCTACGACGGACTATGTCATGCGCATCTTGAACATTAGCGTCAACGCAATGAAAAATGTCAACCTGGTGC
CTATGTAGCATGGTCAAAGCGTATCTTAGGCGAAACAGTATCAAAAAGAGTCAATATGAGCAGCAAATGCCAAGAGCAGAGATATCGACAGCGGGGAATG
CTCCTGCTAGCTGCAACTCGTACAACCACTTGGTCGTGAGCTCAGCGCTCGCTTCATTGCTGCTAGCCTCCGCTCTGCCCCTTGAAGTGACAAATCCAAG
ACGCACGTGATGATCTGCAGCGAGGAAGGCGAGCTCCATTACCCGCGTGACCACGAACGCGTCCGTCCTGCAGTCCCTCAACCGACCTCGTCGTATTGCC
CAATCTGATTTGTCTCCCCTATTTACACGTTTTTAATCGATTTTTTACATTTTTACAGGCGTTTCCACTTAAATTAAGTAAAAAGCTCCGTAAAAAGCCA
ACACTGCTGGTGCGGCTACGTTCGATGTCTCTGCTCGAAGCAGCTGTTCAGCGATCAATTTCGGGTACTGCTCATATTCTGCTCAAATGTGTTTGGGGCG
CTCTTAATGTGTACTCATAGATTGGCGGTGTGGGCCACATTGTCGAAATTGACGAAACAAACCTAACAAAGAAGAGCAAACACAATCGTGGGCGACAATT
CCCGGATTATTGGCTTATTGGTGAGTGGACCGCTCTACTGGAAATTGTTTGGCCGAATTGTTGAAGCGATAGAACCCAGAAGAAGCTATTTCATGCTATT
CGCAAGTTCATCAAGCCTGGGCACAATCGTATTTTCCGCACGTTATGACATATACATCACTGTATCATATTAGCTTGTTTTTTGTGTAGGACAACAATCT
ACTCGGACATGTACGCCACATACGTCACCGAAAGGAACACTAAGGGCGACGTGCGCACCAGAACGCTCGACAACCATCCTTCTCTTTAGGACTTGAACTA
CACGCACAAGTATGTGAACCACTCAGAACACTATGTGGATCCAGAAGCTGGAACACACACGAACACTATAGCAGGCCTGTGAGAGATCCACGTCAAACGC
CACATCAAAGTCATGTGAGGTATGACGAAGAGCGCACTCGATGGCTATTTGGTCGAGTATATGTGACGCTCGTGGTATTTCCCACGGAAGGCTACCACCG
CGCATGTTATGCGTGGCTTAGTGCAGCTAATTAACTGTCATGGGTGTAACAAATAAAATAATTTTTGTTTTGAAATTTCATTTTGAAAAATTACAATAAG
AGAAAGCGGAGCTCTCCATGGAGAGAGTCTAATTAGACGAATGGAGGTGTTCATATTGTTGTTGACTGTAGATTGTTACTATCAACCCATACATAGGAAC
AAGTATAAGTCGACAGAGTCACTGGGCAGCAAAAGCCGCGTTATTTGCTTTATCTAGCTTGTTGTCATGGCCCCCTGCTCCTTCCTTAGTCTTTGTTGAG
GTTAGGGCTCGTCACAGAGCTGACCTCAGTACCGTACTCTTTACAAACTAATTGTGAAGGGATACGGTACTCATGACTCGAAACAAATTCCTGGTAGCGA
CATTATTTAATAGTGTTTCTGACTGCCGTATACAATAAGAAGACAGTAGTGAGAGTCTAGCTTGCTGCTCCACTAATGCAAATCTTCCTTCCTTCCAAAC
TTCTTCATCTCAAGTCTACATTATCCAAGTTTTTCTTCGTGCGGCTGTGCTCTACATCAACAGATCATGAGTCCTAGCCAATCCTCGAGTGACGGCCTCC
CTCGACTTACCGGTGCTCGCAATTTCGACGTTTGGAAGACACGCGTGAGTGCTTCTCTAGAAGGCAAGCACCTCCTCGGTTTCGTCGCCAAGAAGGATTA
CAATGGAGTCAGGGATGATGAAGATGAAGACCGTGGAAGTGGCTCTGACATGTCCGACGACGAAGCCACGACTAAGCGCGCCAGTTGCCGAGGTTGGCTC
AGACGAGGTCGATTTCGAAGACAGCTCAGACGAGCTATAGCCCAGCTGTGACGACGATGATAACCCGTCAGGCAAGAAGCTTAAAAAGAGTGATCTATCT
TCTGTCCGTCCGTTTGCTCAACGCAATACAAGGCGTGAGAAAAAGCAAGTGGGACCTATTCCTCCATCTGCTCGCCAGCTTCGCCGTATGGAAGCGCAGA
CCAAGGCATTTTTGATGAAAACGATGGATGACACTCACATCCGTCTGGTCAAGAACCTCACGACAGCCTTCGGCAACTTCCAGACCATAGGCACGAAGTA
TGAAGGTGCGGCATTCCATGGTGACCCCTGCTTCATCCAGCATTTCCTATGAATATCAAGTACCAAGAGGCAGTGATCTTACTAGCTTCTTCCTCGAACT
AGAAAAACGCGATGAAAGCCACATCCGAAGCGACCGAATCAACCTTGACGGATGTCCAAAAAATCGCTGTATCTGTTCCACTCCATGCCGAAGTCTTAGA
AGGATGATCTCCGAGTTTGGAAAGGCGTGCGGATGTACATTCTGTACGAAGAGCTCAAGATGAGCATTGAGGCCAAGTCCCCTGAAATCGAAGCCCAGTA
GCACTACAGCCTTGCGAAGGGGGCACCTGAAAGCCAAGGCACCAAGGGCGAGCATGCCTTGATTACACCAACACTCCGCATTGGCAGCGCAGACGCCTGC
CCTATCGGATGTCTGCAGCTACTGCCAAAAACCTCGACACAACATCCGCCAATGCCGTGGTCTACAGAAGGATTTGTGTGATGGCAATATCAAGGCTGGC
ACGGCTCTACCGGCTAACTTCGAGCTGCGTATTACCAACACCTACCGGGCGCACCCGTACAATCACAACCAATGCAGTAACAACCGTGGTGGTGGATCGT
GGCATCAAGGTGGTCGTGGTGGTCTCAGTGGTGGTCGTGGTCGTGGCGGCTGTGGTGGAAATCGCGGTAACAACAGCAACTCCCAGTCATCTCGCCGTGA
CGAAGGAGGTTCTGATCAGTCTCGTCGCAAGGTAGCTCTAATCGCAGTAGTGTCTGAGGTTCAGACGGCCACCTCGGCTGCTAGTCTCCGACCTGAAGCC
AACACCGACCTAGATACCAGCTGGACCATCGTTTCAGGGTGCAGCAGTCACGTGTCGCAGCATGCCGAATGGTTCATGACTAAGACTGCAGCGAGCGGAG
GCATCACCGTTGGTGGACAGTCTCAGGTACCAATTGAAACAAATGACGCGGTCGAGATCCTGGTATGTGGCTCTAAGGGGAGCGGACGCTAGTATTGCAC
GATGTCCTCCATAGCCCAAAATTGCAGTACAGCCTACTATCGGTTGCGGCTGGTGTCGATGATGACTATCGCGTCAACTTCAAGCGTACCATGCGCACGG
TCCAGACCAACCAACGCTTCATCATTAAGGCGATGAAATCGTCGACTTCGAAGCTGTACCAGTTCACGGCGCTTGCGGTCCAGAAGGAAGGAGCTCACGT
TGCTACAACAGGTAAAGAAAACGTACTTATGCTATTACACAAACGTCTCGGACACCCTAACATCCGTGTGTTGCAGGTGCTCTCTAAGAACCAAACGCTC
ACCGGTCTCGATGCATTAACCGTATCTCGTCCAGATTCATTTTTCTGCTCTGCATGCACTTATGCGAAGTCTCACCGCGTTCCCTTCCCTTCTAATAGGT
ATCCTGAACGCAGAGATGTGCAACCCCTCGAGTACCTACGACCACCCCCTAATGTGGAAATTCAGGGTTTTCAACCCAACAACGTCAAAGAGTATGAGAA
GCTAGGGCGTATAATTTTCACGAAGCTCGGAACACATGCTGACTTTACAAACGCATACACACCACAAGAATATGGTGTCGTAGAACGACGCGTGCGTATC
ACCATAGAGCGTGTCCAAGCCCTGATCTTGGACACCTCTTTGCCAAAGCAGCTATGGACGGAATGTTTTGGTCATGTTACAACTCTGCTCAATATTACAC
CGAGTGTCAATACGAATGACCGTACGTCGTTCGAGCTATGGCATAACAAAACGCCACCTATTCAATATCTCAAGGTGTTTGGTTGTACTGCAAAGCTTCA
CATTCACGAAATTTAGAAAGATAAGCTGGATGCACGAGCCCAGCTGTGCATTTATCTGGGGATCCCTTAGCATAAGCGAGATAATCGCCTCATGGATGTA
AAAACTCACAGCAAGTCTACTGACGTGATATTGTTTTCAATGAATCGGATTTCCCTGCTCTGGACAACATTGATGTGACGTCCGATCCACCACTGTTACC
AGAACAGTTATTGGAGCGCACCCCACCCGCTGATGTCCATCTGGCAAATTCCTCCGCTGCGCCTCCTGTTCCCATTCCACCAATGAAACCACGTGGAGAT
TCTGTGGTGAAGCGCCAGTTGGCTTTCACGAATAAGAAAACTGATTGATGGGAAATGACCCGATCCAGCCTTGAGACTCATGGTCGACGACGGCGCGTCA
GTGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAATTAGATCTGTCTTCATTCCACAGACTCTTGAGAGAACACCCT
ACGCAATGTCGGAGCAACTTTTTCACATTCACCCTCCTCCGGAAAAAGCCTATCCAAACCATGATGTCGCTGAATCCGCGCTTCATGCGTGGACAAGATC
AAATGGCATCAACGTATCGCGAAGGCGTATACGAAAAAATGACAACGGCGGCAATTGCATCCGAAATTACGAATGCGATCGTGCGGGCAAACCGAAGTGT
ACTCTAAAACTTGCTGCCGAAGACAGGGTTCGAATTAAACGCGGGTCGAAGCGGTGTGGCTGTCTAATGCGGATTTCGTTGAGGGCGATCAACAAAAATG
CACCTGCAGGGGAATGGGCCATCGTCCACACTGGTAATAGTAGCGCTACTTCTACCTGCTCGTCAACGCAAGCAGGAAAAATGAAGAAAACTAAGACAGT
AGCAGATAGATTGTTAACTCGCGAGATGCTACAGCAACCTAACGAGCCTTCTCAAGCAAAGACTCCGAAACAAACCCGAAAACCAGCGAAGAGTAAAAGA
ACTACAAAAACAACATAAGATCATCATCACAACAGGAGTGCAAGCAAGACCACGATATTCACAAAGAACACGAACGGGAGCAGCAAGCAGAAATACCGAC
GACACAAAGCAGCCACAACGATCTGGTTTCGTTTGTTACTTTAAATGATTATTTTTAATTTTATCTATGTTCACAACCACAAACCGTCCATGGACGCTCG
TGTCCACGCAGCTCACAGATCCAGAGCTGCTCAGGATATCATTGCTACTTCTGAGCGCTCAGTTCACAGTATAATTGAGGCCCAATCTGCTGCTGGTGTA
CCTGTAGCCAACATTTACGCAACAATGTTGAATCAAGACCCCAACACTCTGATAGTTCCTAAGGATATCGCGAACGCCAAGGACTCAGCTCGTCGTCGAG
TTCTCACTTCCGCTACGCCTATTGAGGCTCTCTTCAACCAGCTCAACCAAGATAAGATCTTTTATCGATACACAACACACCTCGAAACGCAACGTCTTAA
ATATCTTCTGTGGGCTCATCCTGCTACCGCAAGTCTTTACAAGGTTAACTCCGACATTTTGGTGATGGATTGCACGTACAAGAGTAATAAGTTCGATCTT
CCGCTTCTCAATGTCATCTCACTTACTGGAATGGACACTGTAATCCCTGTATGTCAAGCCTGGATTCCAGGAGAGAAGAAACAAGACTACACTTGGGCTC
TGAACATGTTACGGCTACTGATATTGGAGTATGACGTCCCAGAGCCGAGAATCATTTCGCATGATAGAGACCAAGCGTTAATGAATCCTCTGGCACTCGT
TTTCTCCGACGTACCGACAATTCTGTGTCGATGGCACATGAACAAGAACGTACTGAGTAAAGTAAGAGAAGTGCTGGGCAAGGTGGCTGTCGAAAACCCT
GCTCCTGGTCAATCCAAGTACTCGAATTCTTTGGCCACAGACAAATTTATGGCGCTGTTTTACCGCACAATCGACTTGGAGACGGAAGAGGATTTCCGAG
CAAACAAGGCCGCTCTAGCTGAATCTAACGCCCATCTTGCCGCATATCTGTCGGAGCACTGGTGGAAGTACGAAGACAAGATCGTTAAGGTCCGAACTAA
TCGGTTCATGCACTTTGGTGTTCGAGATACGTCAACTGTCGAGGGGACTCATGCACAATGCAAACGCTGGATCAAGTCTACCCGTGGCGACCTGTTTACT
GTTTACAACAAGTTACTTCCATGGTGGATATCGTCTGCGAGCAGGATGCGCGAGTGTTTGAGCCGCAACGAAACGATAGTCCCTTACCAACTGCAATTCA
ATGAGTTCGCCGCGTGTGTGAAGGTTATAACCAATTGGGCCCTGTATAAGACTGACGAACGTTGGAATCAAGCTCGAAAAAGTATCGTGCAAAGCGAAGC
TCTCCCTGATTGCAGTGGTATCTTCCGCGCTACTCACGGGATGCCGTGTGTACACGAACTCAAAGCAATCATAGANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCGAAATTGAAAACTATATTTGCTGTAGCTCTCGTCGGCAACGCCAAAAATTGGATTTACCGTTGCCGACGGTTCGTTCT
ATTTTTTGCAACAAGTAGCTTTTTTTGTGAGGGCCCTCCCAGCTGGAGGGTCCTCCTTAGTTTTCCCCCTAGCGGTCCAATACCTTCTGCCCATCCTATG
ATGTCCTTTCTATCCCCTCTGTAGCCTGGTCGCGTGGTACTTACTGTGGGTATAAATCAGTTGATGTGTCAACAGTGGATCGTATCCTTGAGGGCCGATC
GCGTATCGAAATGATTGCTCCATGTCGATTTACTCCGATGATTGCGTAATTTTCATCGATGATGATGATGTAATCACTGACGCACCGTCGTCGACCAGGA
GTCTCAGGGCTGGATCGGGTCACTTCCCATCAATCAGATTCTTGTTCGCAAAAGCCAACTGGCGCTTCCCCCCCCCCCCATATATATATACACACTCGCC
CTCCCCCATTTGCAGGCCCAACCCTTTGGTTCCAGCAAGGTACCTCAGTACTCGCTTCCAGTCCGACACTGTGTCGTTGTGGTTCATAAGGCGTTGAAAT
TCACGCACGTCAGCGCCTAATAAGCCCCACTGATAATGTCAGACCTCGTGCAGCGCGCGACCCACAGTAAACTCTCCAATGGTTGAAATTGCTTCACAGC
AATCGCATCCTCAGTACCTCTCACGGGCAAGATCTTCTATTCTCAAGCCTCGCGCTCATTGCACTTCTCATCTTTTGGTGCACGCATCTTGTGTGCACAC
TTCATTTCATACCCCTTGAGAAACGCTTCTATCGTCATCTTCGTCCACAAACATCGTCATACCAAATACACACACCTAGAAATTTGGTCGCTTTGCCCAA
GTCCTTCGCACACAGGTCCGGCAAATCACCGAAGAACGCATATAATCCGGTCTGCTCCATCCCATTGACGAGCAGATCGTCAATGTACAAACCAACCGCC
TGTATTTTGGCTCCATCACGTCGGCAGTATACACCCGTGTCCGTCATGTTCTGCGCAAAGCCAACGTCGTTGCGCTTGCGGTGCAGCAGCTTGCTCCATA
GCATACCCGCCTGTTTCAGGTCATACAAAATCTTCTAAAATCTAGCTCCACCTCGTCACCCTTACCAATGCCCAGTTACTTGATCATTTTTCTGTGATCT
CCATACCCTGTTGGATGTGCATACAGATGTCCAGGTCCTTTCGCTTCTCAGCTTTGACATATACGTTGGGCTCGTCACCGTAGATTCCCCGCGCGCCCCA
TTTCCTCGCCAACACTACGGTAAGCTTGACATTGGACAAGTCGATCCTCACCGCGACCGTCACACTGTAGTTTACGTCGAATATGTAAAAGTTGCCACAA
GCAACGAGCCGCTCGTTGATCGGGGATCGATAGTGCCCTCAGCAATACGTTTGGTATTAAAGACCCACTTCCCTGCAAGGTGCGCGTCCCTGTCGGCAAA
CGCACGATTTTCCAGATGTCCAGCTTAATAAATCGTTCCTGCTCCTCAATTCTTTTGGGTCTGCTTGCTCCCACCGCCTCGCGATAGTTTTTCGGATCCA
CTTCAACCGCAACGACGTCCGATCTAGTCTCTTCTGCTGTCTACCAGCTACGTTTCCTCCATCCGACTTCCGTCCAACTGACGCACCACCGGATACTTTC
TCGTCCAATATTTCTTTTTAATTCTTGCTTGCTGATTCTTGCGTTAACTCGCGGTTTCTGCATCAGTATCCAACCCTTAACCGTGTTTCGCCACTCTCGC
TTCACAGCACCATCACTGTTCGTAGCCGTCTCACATGCACGACTCGTTGTGCGCTCGACAGGCAAAGGTCATTCCCTTCCGTAAACGGTTGTTCTGTGTC
TTCGGTCTTGGCCGTTCATCTTCCAGGTAACGTCCGTCCTCACTCTGCTCTTTTTTTAGTGTCTTAACATGCTGCACCGTCACCACGACCTCACGCTTAG
GCAGGTACACTCTGAATCCTTTCGTCTCCTTCATCGCACCGACGATCATTCCTTAATGCGCTCGTTACACAACGTGTGTTCTTACGTGGTCCTCTATAGA
CTGTGCACGGTGAGCCCAAGACCACGATCTTGCTCACCGACAGGGTATTCTTCCTCTCCTCAACATCTTCATTGGAGATGCACGCTCTTGTTTGGCACTT
GCCCGCGATCGCTTCAGTATGTAGGTCGTGTATTGGGCTGCGTCCCGCGAAATACGTAGTGACATCCACAAGCAAACACCACGCATCTGACCATATTCAT
TATGTTCCAAATCATTCGCTTTGCTTTCCCGCCCCTTGCTTGGTTTCGAGTATCGCTACTTTGGCGTGCGACGCTAGTGCTCTTTCCAGACAATTACACA
TCACCGAAGTCCGTGCGCAACACATGGATCCTACAACTGAATTTGTTTTCGATGAGCGCCAGGAAGTACTCAAAATTCCTCGTCTCCACGTTCTTAGTTC
GCTCGAAAGACGCTACGGTAATTCGTTTAATGGACCACCATATTAATATCCACTGCTCAGTTGGTCTCTCAGTGTCATGGACCCCTTGCGATCTGATCAT
ATCATGCCAGCAAAGCGATCTATTGCCGCATATTCACCGGGGTTTCCCGAACTGTTTGCACTTTGTTTGCTTACCTTCCACGCAAAGCAAACAATATACT
TGTCTTTGACTCGTAAACACAATCCCATGCTCGGATCCAATGCGAGTTTGTCCCCAGTATCGTAGCTCAGGTGACCAAGTCTACGGTGGAGGTTCTCCAA
CGTGCCTCGCTGTATGTCCGTCGTCTCTTCGGCGGGCCATTCGGCATCCTCAGCCAGAGCCGCCGTAACCACTTCCGATTCTGCCGCCTCTTGATGCACC
CTACCGCCAGCATGTTCCTCTGTAATTCTACGCCGACCCCGGTACGCACTCGGCGTTAAACTTCTCCGTTGACTTCAGCTTTTGTTTACCGCCGCACGCG
GTGACCATGAGTTCCAGCTCACCCCCTCGTGACCTTCAGCGCCGCGTCGTTCAGCTGGGCACACTTGTTCTCGCATTTCCGACCTCTTTCAGCCATGACA
CGTTGCTCACTGGGGGATCCACATCTCGCCCATCGGACCCGACGTCTCCTTCACGGCGAGCGTAAGGTCAGACACGCTGTCGAGTCCCCGGACTCGGTTT
GCACACTTAGCCCGCAGATGTTCCAACTTACCGTGTTGATGACACTCACGCATTTCCACAAAACGTCGGACTCCTTCACTCTATCTTCACTGAGTATACT
GGATCAGGTTTGAACTACACAGGGGCATATCCAGCTTCTTTCTTCCGGATCGTTGAGAGCTTGTCGAGGCTGCCGTACCGATTACACGGAAACAAATTCG
AGAGCGTAAGCCTTCTGTGGTCAGTAAGGGCGTGACTTCCACCGCGTTGACAGTGATAAGCTCTTCGATGCATAGCAGACACATATCTTGACAACAACAT
AACATGTTGAAGAAAAAATGGTTCACAGTATTATCCAGACTGTCGAGCCTGTATTAAACGTCCAGTCTGTCAAGCGTTCCAAGGTGTACGAACAGGTGGA
ATCTGCTAACATTTTAACCTAACCTACCCACAAACTCTATACGCGGTGGTTTCAAATCAGAGTTGGGCTATCCACCCAACACGCTATAACAAAAAAAAGA
TGTGCGCGGAGCGTAAGTTTTGTGGCTTTAAGATCGAGAGTCCTGGTCGTTACCGTCGGGCACACCTATCCATTATCAGATACATCGAGGATAAAGAATC
GTAATTGGTATTACCGCGATATTGCAATGACATTATATCCAATCTCAGCTGCGCAAAGCCGCGAATTACTGTCGAACCGGTCAGCCATCTACTTGAAAAA
AAAAACGCGTACATATCTTCCCAGGCCATACACGTTTGACCAAGAAACTCGCCAACTAGAACACGATCCACCGAAGTTGTCCTATTGCCGGCAATGTTGT
CGCAATTGAAGGGATCATCGCTGTTACTGTTGCTTTGGCTGAAAAATCGAAAGACACGTGGTAGCTACCTTCTCCCTACACACTAAAGGATTTGAGCCGG
TTCAGTTCCTATTTCAGGATTTGATCCGACCTCTTTAGCAGAATGCGCGGAGTATTCTCTACGGAGGATGCCCCACAATACGGCCCGGCGTAGTTTCAGG
TGAGTGACTGGAGGGATAGGTGGCGAAGTCCGAATTTTTGGTCTTGACACGAGCGACAACACCAACGTTCTCGTGAAAGATACATCGCTTGAATATTCGC
CCCGAATGGCGAATAGGGTGTTCAATGATTTGAATTGCTGTGCTGCGAATTGTTTTGTGACTTATTGACAAAAGGGACAGGAGCTTTTCGATCATCGTAA
ACTGATAAATAATACGATCTATGTGAACACCAGGCTGTTGCCCTCTTGGACTTCCTCACTGCCCAGAGGTTTGCTATTACTGAACCTCGGTCGGTATATA
TACACATCCCTCAGAGTGCCTTCGTTTACCTGATCATTCCGCTTGAACTTCATATAGATATACCAGCTCTGGCCTGCTTGGTCAAGCAGCGCCTCCAAGA
TGGTTAATTAGATGAGGCAGCGCCCAACTGCATCAGCTGATTAACATTTACAGATATACACCTATCGACGCGTTCGGTCTATAAGGAGAGGAATACATAC
TAGTCTTGAATTAACAGTAAATAGAGGGTACATTTTGTAATGATGCCAATTGCGATTTAGACGAAAGCGGAAATGTATGCCGTAAAATGACTTGATGCAA
ATAGTTTGTTGTAGAAATGGACAATACGCTTTTTACCTTTGATTGTTTTTTTTTCGATTTTACTTGAATCAAAAAATCATTCTAAAATTAATTTATATTC
AAGCAGAATTATTGGTCGAGTGAGCGTCTATAGCAATTGTCAAAATTTTGTCGATCCGGTGTGAAATTGTTGTTCATCTATTTGCTTCTAATAAAACAAA
TAAAACAGTACATTATCGTCGTCTGTTCCGACTTATCAGCTTTTATTAAAAAAAAACACTTTGCTACTACTATCAGCTTTTATTTAAAAAAAAAAAACTG
ACACAAACAGGTAAACTGAATTTAAGGTAGGCTTGCCGACTTGATCAGCTGAAGTTTAGATACTGTAGCTAATCTAAATGTAACTGGAATCCAAGTTATA
AGTATGCTGTTAGGCCTACATTGCAGGATCTAAGATGTAAGGTCACCATGTTAAATCCACAGGTACATGTATGACTTCACATTAAATATTAGCCAAAAGA
TAACTCAAGGCTGGCAGGAAAATAATTGCCGAAGTGCCGAGTTGTCGTGATCTGCAGCACCATTGCAATTCCCTTTGGCATCGCGTGTTGTACAGCCTGC
ACTACAAGGTACATGTAGAGCACGATTCTTTGGTGCCTGGTCAGGACATTCATATCCAGGATGTCTACAACTGTGTATACATCACATAATGTAGTGTGCG
TTTGGTATACATGTATGTAAAAAGGTGTACATGCACATAAATGCACGTTGTCGTACGCGCTCACCCTTTTTAGGCTTCGCTGTCACGTAATACAATATGT
CCGTGCTGTGCACCAAAAATTAATTCATTTACTAAAAATAATTATTAACACGAGCAGAAACCAGTTCCTTTCCGGTGACGCGATGCTCGTCGTGACAATA
TGGAATGGGATCGCAGCAAGGTATCCTCGTATACACATTCTAGTCGCGGACCGGATATGGGGATGCTTCTCCGGGGAGTTCCCATACTATGGATACTATG
GAGTGAACTCGGGTTCCGGGAAATCGCAGTTTGAGCTCATGTACAATAGTGTACAGTATGATACAGTGTGTATCATGCACCGGAACCCTGCGAATTGCTG
CACAGGGGATGGGCGGCGCTCCGTCTCGGGTGAAATGGTGCCGCGCATCCTTCCTCCTTCAGTTATTTTTAATAACATGCGAGGTGGCAGGCCCATCTAG
GGCGGCTGTATTAATACATGCGCCCATCGCCTTTGTGTACGGAACAGTTGGAACTGTTTAATGCCTTAAGGTATTAAACTGTAAGATCAGACCTATTCTT
GATTAAATATTTTAATACACGTCTTGAAATACTTCATGAAATACATACAAACGCACATCCGGATGAACTGTACGGGTTTTCACTGCTTTGCCTGCATGTG
GTGCTCCGTATCTTCGTCAGCAAGTCTCTGCTCTGCTCTGCTGCAACAGCAACTTGTTGCAGCAGGGACATGAGTTTTGTAGCGAAGAAACTCAGCCGCT
TCTAATCCCTAGCACTGGTGCAGCCAAGTTAAGCCGATAATGGTGCACTCTTGCACAGCGAAGTAACTGCTTTGCACGAATACTTGCATCCAGTATGCTT
GCTACAACAAAAGAGCCGTCAAGCGCATCGACTCTGTT